Ресанта асн 500 1 ц неисправности: Ресанта АСН-500/1-Ц инструкция, характеристики, форум, отзывы

Содержание

Стабилизатор напряжения Ресанта АСН 500/1 Ц (Настенный)

Настенный стабилизатор напряжения Ресанта АСН 500/1 Ц

 

Стабилизаторы напряжения от фирмы «Ресанта» отлично подходят как для эксплуатации в частных домах, так и на промышленных предприятиях. Среди представленных на рынке моделей следует отметить стабилизатор напряжения Ресанта АСН 500/1 Ц (Настенный), который отличается надежностью в работе, стабильностью характеристик и доступной стоимостью. Заказать данное оборудования вы можете на сайте нашего интернет-магазина!

 

Функции модели

 

 

Что о нем следует знать?

 

1

Применяется для ступенчатого добавления напряжения, а не плавного.

2

Лицевая панель оснащается такими приборами, как амперметр и вольтметр, необходимыми для контроля текущих параметров сети.

3

Устройство предназначено для работы в широком диапазоне температур окружающей среды.

4

Не допускать эксплуатации вблизи источников теплового излучения, не закрывать вентиляционные отверстия.

 

Стабилизаторы напряжения Ресанта АСН 500/1 Ц (Настенные) — надежные устройства с большим функционалом. Сделать заказ вы можете уже прямо сейчас!

 

Схема заказа Стабилизатора напряжения Ресанта АСН 500/1 Ц

 

Оформить заказ на сайте или по телефону

Консультация менеджера и согласование всех нюансов

Оплата удобным способом

Доставка выбранным способом

Дополнительные характеристики
Товар сертифицирован Да
Гарантия 1 год
Вес в упаковке 2.55 кг
Вес без упаковки 2.04 кг
Страна производства Китай
Габариты, см 11 х 20 х 26
Страна бренда Латвия
Комплектация Стабилизатор напряжения РЕСАНТА
Кронштейн для монтажа на стене
Инструкция
Упаковка
Технические характеристики
Тип Релейный
Мощность 500 Вт
Напряжение сети 220 В
Тип входного напряжения Однофазный (220 В)
Размещение Настенное
Охлаждение Естественное
Класс защиты IP20
Питание От электросети
Выходное напряжение 202 — 238 В
Габариты, см 11 х 20 х 26
Высоковольтная защита 240 — 250 В
Вес без упаковки 2.04 кг
Страна бренда Латвия
Точность стабилизации 8 %
Скорость стабилизации 35 В/с
Частота 50 Гц
Рабочая температура 0 — 45 °C
Возможности цифровая индикация (вольтметр отображает входное и выходное напряжения)
КПД 97 %
Страна производства Китай
Влажность воздуха 80 %
Штрихкод EAN-13 4606059015338
Выходные розетки 1
Входное напряжение 140 — 260 В
Максимальный потребляемый ток 2.6 А
Серия АСН
Комплектация Стабилизатор напряжения РЕСАНТА
Кронштейн для монтажа на стене
Инструкция
Упаковка
Штрихкод GTIN 04606059015338
Время отклика 7 мс
Защита от короткого замыкания, от перегрева, от повышенного напряжения, от помех
Вес в упаковке 2.55 кг

Купить

Однофазный стабилизатор напряжения Ресанта АСН-500/1-Ц

Пусконаладочные работы (ПНР) – Наши специалисты осуществят комплекс мер по подключению и настройке оборудования на следующих условиях:
кабель требуемого сечения должен быть подведен к месту установки оборудования и иметь с каждой из сторон обязательный монтажный запас.
концы кабеля должны быть промаркированы пофазно;
оборудование   должно  быть   установлено на место, отвечающее указанным  в  паспорте требованиям    завода-изготовителя.
Монтаж – Комплекс действий по сборке, установке и подключению оборудования. Монтаж оборудования может включать в себя штробление, прокладку кабель-канала, врезку кабеля в щит, сборку оборудования на месте установки, непосредственно подключение и тестовый запуск. Стоимость работ зависит от сложности и удаленности объекта.
Шеф-монтаж – Наши сотрудники осуществляют технический контроль над исполнением монтажных и пусконаладочных работ сторонними специалистами.
Сервисное Обслуживание
– Наши специалисты проводят индивидуальный контроль над действующими объектами и системное сервисное обслуживание на согласованных с заказчиком условиях.
Ремонт / Гарантийный ремонт – Компания «ВП-АЛЬЯНС» располагает сервисным центром, предлагая гарантийное обслуживание и текущий ремонт оборудования. ВАЖНО! Транспортные расходы, связанные с доставкой изделия для проведения гарантийного ремонта в адрес ПОСТАВЩИКА несет ЗАКАЗЧИК. Гарантийный ремонт или замена приобретенного изделия в течение гарантийного срока осуществляется только при соблюдении следующих условий:
наличие товарной накладной на изделие;
наличие  оригинальной  упаковки и сопроводительной  документации  входящей в комплект  с      изделием;    
наличие квитанции (или платежного поручения) об оплате изделия.
Мы выполняем пусконаладочные работы по всей территории Российской Федерации и рекомендуем пусконаладку всем, заинтересованным в долговечной и надежной работе своего оборудования.

Какой стабилизатор напряжения выбрать. Лучшие стабилизаторы напряжения для дома

Стабилизаторы бывают однофазными и трехфазными, а также цифровыми и электромеханическими (латерными). 

В зависимости от типа питающей сети стабилизаторы подразделяются по значению выходного напряжения на однофазные (220 В) и трёхфазные (380 В). Выбор зависит от того, как напряжение подведено в дом. Если подведено однофазное напряжение, подойдет только однофазный стабилизатор. Если к вашему дому подведено трехфазное напряжение, есть 2 варианта: купить один трехфазный стабилизатор или три однофазных. 

Цифровые или электронные стабилизаторы, в свою очередь, делятся по способу коммутации на релейные и тиристорные. 

Релейные стабилизаторы – самые популярные, т.к. имеют ряд преимуществ: 

— надежны 

— выдерживают перегрузки 

— долговечны 

— быстро реагируют на перепады 

— принимают входное напряжение в любом диапазоне 

— не вносят радиопомех, поэтому подходят для использования с самыми разными электроприборами 

— компактны – могут быть установлены в квартирах 

Тиристорные модели используют для работы с оборудованием, требующим высокой точности выходного напряжения, например, медицинским. Но они менее надежны и не так удобны в эксплуатации. Еще один минус – цена самого стабилизатора и ремонта в случае поломки. Для работы телевизора, холодильника и другой бытовой техники чрезмерная точность не нужна – все эти приборы нормально работают при напряжении 220 В ± 10%. 

Электромеханические стабилизаторы латерного типа отличаются высокой точностью (2-3 %) и плавной регулировкой напряжения, но гораздо медленнее срабатывают при изменениях в электросети. Такие модели не приспособлены к перегрузкам и не отличаются надёжностью, требуют регулярного техобслуживания, имеют сравнительно большие размеры. Доступная цена – вот главное преимущество электромеханических стабилизаторов. 

Мощность 

Чтобы сделать правильный выбор, нужно еще учитывать мощность стабилизатора. Для бесперебойной работы стандартного набора «чайник-холодильник-телевизор-плита» мощности 10-15 кВт более, чем достаточно. Для точного расчета следует сложить мощность всей домашней техники, которую вы собираетесь подключать к стабилизатору. Учитывайте пусковые токи некоторых приборов, например, кондиционера, холодильника, микроволновки. Мощность этих приборов при запуске превышает номинальную в несколько раз. Если не учесть данного факта, при включении техники с высоким пусковым током остальные приборы могут отключиться – сработает защита стабилизатора от перегрузки. 

Стабилизатор напряжения серии LUX РЕСАНТА АСН-5000Н/1-Ц

Стабилизатор напряжения серии LUX РЕСАНТА АСН-5000Н/1-Ц релейного типа предназначен для выравнивания входного напряжения и защиты приборов от перепадов напряжения с суммарной мощностью до 5 кВт. Работает с напряжением 220В с точностью до +/-8%. Устройство оснащено фильтрами сетевых помех, предотвращающими искажение частотной синусоиды, микропроцессорным управлением и цифровым индикатором напряжения. Превышение пределов поддерживаемого входного напряжения автоматически отключает подачу питания. Прочный корпус защищает внутренние узлы аппарата от повреждений. Данный стабилизатор может обеспечивать стабильным питанием — телевизор, ресивер, DVD проигрыватель, кассовый аппарат, газовый котел.

Особенность данного стабилизатора в возможности крепления его на стену.

За счет своего принципа работы такой стабилизатор позволяет моментально реагировать даже на самые значительные и частые изменения напряжения в сети и предотвратить выход оборудования из строя. Номинальная мощность при входящем напряжении 190В составляет 5000Вт. Количество фаз = 1.

Системы защиты:
— Защита от выхода напряжения за пределы рабочего диапазона стабилизатора (рабочий диапазон стабилизатора от 140 до 260 В).
— Термозащита (тепловая защита) позволяет выключиться стабилизатору при превышении его мощности нагрузки над мощностью самого устройства.

Преимущества:
— Встроенные фильтры входных и выходных частотных помех
— Автоматическое отключение питания при превышении предельного значения напряжения
— Широкий диапазон поддерживаемого входного напряжения
— При кратковременных перегрузках прибор не выключается
— Автоматическое включение при выравнивании напряжения в пределах рабочего диапазона
— Микропроцессорное управление
— Компактные габариты
— Высокая скорость срабатывания защиты
— LCD дисплей (жидкокристаллический)
— Индикаторы дисплея отображают все параметры защити нагрузок стабилизатора, в том числе, входное/выходное напряжение, включение любой из защит, отображение величины нагружения стабилизатора. Также, на дисплее отображен обратный отсчет времени задержки
— Время регулирования напряжения минимально и составляет менее 15 мсек. Т.е. менее 1 секунды
— Навесное исполнение

% PDF-1.3 % 2406 0 объект > эндобдж xref 2406 885 0000000016 00000 н. 0000018075 00000 п. 0000018224 00000 п. 0000024171 00000 п. 0000024333 00000 п. 0000024404 00000 п. 0000024510 00000 п. 0000024617 00000 п. 0000024871 00000 п. 0000025115 00000 п. 0000025232 00000 п. 0000025411 00000 п. 0000025606 00000 п. 0000025722 00000 п. 0000025844 00000 п. 0000025976 00000 п. 0000026105 00000 п. 0000026239 00000 п. 0000026437 00000 п. 0000026553 00000 п. 0000026681 00000 п. 0000026817 00000 п. 0000026950 00000 п. 0000027085 00000 п. 0000027218 00000 н. 0000027347 00000 п. 0000027481 00000 п. 0000027675 00000 п. 0000027801 00000 п. 0000027930 00000 н. 0000028067 00000 п. 0000028200 00000 н. 0000028400 00000 п. 0000028516 00000 п. 0000028648 00000 п. 0000028844 00000 п. 0000028961 00000 п. 0000029082 00000 п. 0000029227 00000 п. 0000029362 00000 п. 0000029492 00000 п. 0000029623 00000 п. 0000029763 00000 п. 0000029900 00000 н. 0000030042 00000 п. 0000030181 00000 п. 0000030311 00000 п. 0000030451 00000 п. 0000030577 00000 п. 0000030714 00000 п. 0000030844 00000 п. 0000030981 00000 п. 0000031179 00000 п. 0000031332 00000 п. 0000031489 00000 п. 0000031662 00000 н. 0000031828 00000 п. 0000031984 00000 п. 0000032141 00000 п. 0000032314 00000 п. 0000032482 00000 п. 0000032647 00000 п. 0000032831 00000 п. 0000032993 00000 п. 0000033153 00000 п. 0000033341 00000 п. 0000033536 00000 п. 0000033701 00000 п. 0000033881 00000 п. 0000034060 00000 п. 0000034198 00000 п. 0000034336 00000 п. 0000034520 00000 п. 0000034663 00000 п. 0000034795 00000 п. 0000034944 00000 п. 0000035104 00000 п. 0000035298 00000 п. 0000035427 00000 п. 0000035556 00000 п. 0000035741 00000 п. 0000035875 00000 п. 0000036011 00000 п. 0000036171 00000 п. 0000036334 00000 п. 0000036535 00000 п. 0000036662 00000 н. 0000036790 00000 н. 0000036935 00000 п. 0000037081 00000 п. 0000037224 00000 п. 0000037430 00000 п. 0000037560 00000 п. 0000037696 00000 п. 0000037848 00000 п. 0000038009 00000 п. 0000038154 00000 п. 0000038345 00000 п. 0000038485 00000 п. 0000038624 00000 п. 0000038779 00000 п. 0000039017 00000 п. 0000039138 00000 п. 0000039269 00000 п. 0000039398 00000 п. 0000039529 00000 п. 0000039661 00000 п. 0000039801 00000 п. 0000039998 00000 н. 0000040154 00000 п. 0000040349 00000 п. 0000040554 00000 п. 0000040682 00000 п. 0000040882 00000 п. 0000041010 00000 п. 0000041146 00000 п. 0000041368 00000 п. 0000041506 00000 п. 0000041649 00000 п. 0000041793 00000 п. 0000041982 00000 п. 0000042124 00000 п. 0000042278 00000 п. 0000042499 00000 п. 0000042637 00000 п. 0000042774 00000 н. 0000042920 00000 н. 0000043064 00000 п. 0000043201 00000 п. 0000043344 00000 п. 0000043490 00000 п. 0000043664 00000 п. 0000043817 00000 п. 0000044003 00000 п. 0000044195 00000 п. 0000044373 00000 п. 0000044570 00000 п. 0000044706 00000 п. 0000044838 00000 п. 0000045034 00000 п. 0000045148 00000 п. 0000045275 00000 п. 0000045418 00000 п. 0000045561 00000 п. 0000045758 00000 п. 0000045873 00000 п. 0000046001 00000 п. 0000046147 00000 п. 0000046291 00000 п. 0000046476 00000 п. 0000046590 00000 н. 0000046718 00000 п. 0000046862 00000 н. 0000047006 00000 п. 0000047194 00000 п. 0000047308 00000 п. 0000047436 00000 п. 0000047581 00000 п. 0000047769 00000 п. 0000047883 00000 п. 0000048012 00000 п. 0000048156 00000 п. 0000048301 00000 п. 0000048486 00000 п. 0000048600 00000 н. 0000048728 00000 н. 0000048873 00000 п. 0000049018 00000 п. 0000049202 00000 п. 0000049316 00000 п. 0000049444 00000 п. 0000049589 00000 п. 0000049735 00000 п. 0000049923 00000 н. 0000050037 00000 п. 0000050165 00000 п. 0000050309 00000 п. 0000050453 00000 п. 0000050567 00000 п. 0000050697 00000 п. 0000050841 00000 п. 0000050986 00000 п. 0000051154 00000 п. 0000051324 00000 п. 0000051508 00000 п. 0000051708 00000 п. 0000051820 00000 п. 0000051988 00000 п. 0000052175 00000 п. 0000052289 00000 п. 0000052417 00000 п. 0000052562 00000 п. 0000052759 00000 п. 0000052873 00000 п. 0000053001 00000 п. 0000053145 00000 п. 0000053259 00000 п. 0000053388 00000 п. 0000053532 00000 п. 0000053676 00000 п. 0000053856 00000 п. 0000054012 00000 п. 0000054191 00000 п. 0000054394 00000 п. 0000054542 00000 п. 0000054691 00000 п. 0000054875 00000 п. 0000055047 00000 п. 0000055219 00000 п. 0000055357 00000 п. 0000055506 00000 п. 0000055644 00000 п. 0000055791 00000 п. 0000055965 00000 п. 0000056137 00000 п. 0000056327 00000 п. 0000056448 00000 н. 0000056597 00000 п. 0000056734 00000 п. 0000056901 00000 п. 0000057051 00000 п. 0000057201 00000 п. 0000057342 00000 п. 0000057501 00000 п. 0000057693 00000 п. 0000057872 00000 п. 0000058011 00000 п. 0000058203 00000 п. 0000058385 00000 п. 0000058521 00000 п. 0000058682 00000 н. 0000058835 00000 п. 0000058948 00000 н. 0000059125 00000 п. 0000059278 00000 н. 0000059416 00000 п. 0000059538 00000 п. 0000059733 00000 п. 0000059928 00000 н. 0000060051 00000 п. 0000060173 00000 п. 0000060317 00000 п. 0000060488 00000 п. 0000060643 00000 п. 0000060797 00000 п. 0000060920 00000 п. 0000061040 00000 п. 0000061183 00000 п. 0000061354 00000 п. 0000061507 00000 п. 0000061676 00000 п. 0000061834 00000 п. 0000062012 00000 н. 0000062127 00000 п. 0000062265 00000 п. 0000062420 00000 п. 0000062608 00000 п. 0000062723 00000 п. 0000062861 00000 п. 0000063014 00000 п. 0000063130 00000 н. 0000063267 00000 п. 0000063420 00000 п. 0000063536 00000 п. 0000063678 00000 п. 0000063834 00000 п. 0000064021 00000 п. 0000064176 00000 п. 0000064295 00000 п. 0000064436 00000 н. 0000064591 00000 п. 0000064744 00000 п. 0000064898 00000 п. 0000065095 00000 п. 0000065211 00000 п. 0000065361 00000 п. 0000065571 00000 п. 0000065697 00000 п. 0000065819 00000 п. 0000065956 00000 п. 0000066165 00000 п. 0000066370 00000 п. 0000066510 00000 п. 0000066651 00000 п. 0000066791 00000 п. 0000066911 00000 п. 0000067033 00000 п. 0000067219 00000 п. 0000067374 00000 п. 0000067552 00000 п. 0000067745 00000 п. 0000067876 00000 п. 0000068003 00000 п. 0000068142 00000 п. 0000068282 00000 п. 0000068421 00000 п. 0000068568 00000 п. 0000068718 00000 п. 0000068874 00000 п. 0000069020 00000 н. 0000069178 00000 п. 0000069327 00000 п. 0000069458 00000 п. 0000069570 00000 п. 0000069724 00000 п. 0000069878 00000 п. 0000070024 00000 п. 0000070183 00000 п. 0000070328 00000 п. 0000070512 00000 п. 0000070694 00000 п. 0000070815 00000 п. 0000070963 00000 п. 0000071158 00000 п. 0000071273 00000 п. 0000071392 00000 п. 0000071556 00000 п. 0000071718 00000 п. 0000071862 00000 п. 0000071994 00000 п. 0000072158 00000 п. 0000072304 00000 п. 0000072462 00000 п. 0000072618 00000 п. 0000072750 00000 п. 0000072913 00000 п. 0000073070 00000 п. 0000073217 00000 п. 0000073362 00000 п. 0000073501 00000 п. 0000073642 00000 п. 0000073794 00000 п. 0000073937 00000 п. 0000074092 00000 п. 0000074224 00000 п. 0000074370 00000 п. 0000074516 00000 п. 0000074658 00000 п. 0000074779 00000 п. 0000074954 00000 п. 0000075079 00000 п. 0000075195 00000 п. 0000075337 00000 п. 0000075470 00000 п. 0000075626 00000 п. 0000075770 00000 п. 0000075927 00000 п. 0000076080 00000 п. 0000076230 00000 п. 0000076362 00000 п. 0000076495 00000 п. 0000076642 00000 п. 0000076786 00000 п. 0000076937 00000 п. 0000077088 00000 п. 0000077234 00000 п. 0000077398 00000 п. 0000077539 00000 п. 0000077671 00000 п. 0000077811 00000 п. 0000077954 00000 п. 0000078094 00000 п. 0000078251 00000 п. 0000078397 00000 п. 0000078545 00000 п. 0000078691 00000 п. 0000078813 00000 п. 0000078960 00000 п. 0000079110 00000 п. 0000079282 00000 п. 0000079413 00000 п. 0000079595 00000 п. 0000079759 00000 п. 0000079880 00000 п. 0000080072 00000 п. 0000080204 00000 п. 0000080411 00000 п. 0000080530 00000 п. 0000080694 00000 п. 0000080832 00000 п. 0000080968 00000 п. 0000081109 00000 п. 0000081276 00000 п. 0000081408 00000 п. 0000081543 00000 п. 0000081672 00000 п. 0000081805 00000 п. 0000081940 00000 п. 0000082069 00000 п. 0000082202 00000 п. 0000082408 00000 п. 0000082527 00000 н. 0000082654 00000 п. 0000082791 00000 п. 0000082927 00000 н. 0000083068 00000 п. 0000083211 00000 п. 0000083359 00000 п. 0000083527 00000 п. 0000083698 00000 п. 0000083882 00000 п. 0000084060 00000 п. 0000084184 00000 п. 0000084302 00000 п. 0000084459 00000 п. 0000084597 00000 п. 0000084775 00000 п. 0000084962 00000 н. 0000085094 00000 п. 0000085238 00000 п. 0000085397 00000 п. 0000085535 00000 п. 0000085680 00000 п. 0000085822 00000 п. 0000085983 00000 п. 0000086143 00000 п. 0000086302 00000 п. 0000086462 00000 п. 0000086621 00000 п. 0000086781 00000 п. 0000086929 00000 п. 0000087103 00000 п. 0000087232 00000 п. 0000087352 00000 п. 0000087488 00000 н. 0000087672 00000 п. 0000087797 00000 п. 0000087917 00000 п. 0000088102 00000 п. 0000088238 00000 п. 0000088375 00000 п. 0000088496 00000 п. 0000088618 00000 п. 0000088763 00000 п. 0000088896 00000 н. 0000089045 00000 п. 0000089190 00000 п. 0000089348 00000 п. 0000089501 00000 п. 0000089657 00000 п. 0000089859 00000 п. 0000089971 00000 п. 00000 00000 п. 00000

00000 п. 00000

00000 п. 00000 00000 п. 00000 00000 п. 00000 00000 п. 0000091114 00000 п. 0000091231 00000 п. 0000091350 00000 п. 0000091491 00000 п. 0000091689 00000 п. 0000091805 00000 п. 0000091924 00000 п. 0000092064 00000 н. 0000092260 00000 п. 0000092377 00000 п. 0000092497 00000 п. 0000092638 00000 п. 0000092827 00000 н. 0000092943 00000 п. 0000093063 00000 п. 0000093203 00000 п. 0000093405 00000 п. 0000093522 00000 п. 0000093641 00000 п. 0000093781 00000 п. 0000093980 00000 п. 0000094096 00000 п. 0000094215 00000 п. 0000094356 00000 п. 0000094472 00000 п. 0000094593 00000 п. 0000094733 00000 п. 0000094849 00000 п. 0000094968 00000 п. 0000095109 00000 п. 0000095293 00000 п. 0000095466 00000 п. 0000095648 00000 п. 0000095848 00000 н. 0000095966 00000 п. 0000096085 00000 п. 0000096225 00000 п. 0000096432 00000 н. 0000096549 00000 п. 0000096669 00000 п. 0000096809 00000 п. 0000096997 00000 н. 0000097114 00000 п. 0000097232 00000 п. 0000097371 00000 п. 0000097564 00000 п. 0000097681 00000 п. 0000097799 00000 н. 0000097938 00000 п. 0000098124 00000 п. 0000098240 00000 п. 0000098360 00000 п. 0000098499 00000 п. 0000098689 00000 п. 0000098805 00000 п. 0000098923 00000 п. 0000099062 00000 н. 0000099250 00000 п. 0000099366 00000 н. 0000099485 00000 н. 0000099626 00000 н. 0000099813 00000 н. 0000099929 00000 н. 0000100047 00000 н. 0000100186 00000 н. 0000100370 00000 н. 0000100485 00000 н. 0000100604 00000 н. 0000100744 00000 н. 0000100861 00000 н. 0000100979 00000 н. 0000101118 00000 п. 0000101233 00000 н. 0000101352 00000 н. 0000101491 00000 н. 0000101685 00000 н. 0000101871 00000 н. 0000102052 00000 н. 0000102240 00000 н. 0000102355 00000 п. 0000102473 00000 н. 0000102613 00000 н. 0000102812 00000 н. 0000102928 00000 н. 0000103046 00000 н. 0000103186 00000 п. 0000103388 00000 н. 0000103503 00000 н. 0000103621 00000 н. 0000103760 00000 п. 0000103963 00000 н. 0000104078 00000 п. 0000104197 00000 н. 0000104336 00000 п. 0000104451 00000 п. 0000104569 00000 н. 0000104708 00000 н. 0000104823 00000 н. 0000104941 00000 н. 0000105080 00000 н. 0000105258 00000 н. 0000105432 00000 н. 0000105620 00000 н. 0000105774 00000 п. 0000105891 00000 н. 0000106012 00000 н. 0000106154 00000 п. 0000106336 00000 п. 0000106524 00000 н. 0000106723 00000 н. 0000106840 00000 н. 0000106961 00000 п. 0000107104 00000 п. 0000107221 00000 н. 0000107342 00000 п. 0000107484 00000 н. 0000107601 00000 н. 0000107722 00000 н. 0000107863 00000 н. 0000108046 00000 н. 0000108222 00000 п. 0000108393 00000 п. 0000108586 00000 н. 0000108754 00000 н. 0000108928 00000 н. 0000109134 00000 п. 0000109253 00000 н. 0000109390 00000 п. 0000109535 00000 п. 0000109654 00000 н. 0000109792 00000 н. 0000109934 00000 н. 0000110052 00000 н. 0000110190 00000 п. 0000110332 00000 н. 0000110525 00000 н. 0000110698 00000 п. 0000110876 00000 н. 0000110993 00000 п. 0000111113 00000 н. 0000111254 00000 н. 0000111371 00000 н. 0000111493 00000 н. 0000111634 00000 н. 0000111860 00000 н. 0000112045 00000 н. 0000112231 00000 п. 0000112348 00000 н. 0000112469 00000 н. 0000112611 00000 н. 0000112728 00000 н. 0000112897 00000 н. 0000113034 00000 н. 0000113175 00000 н. 0000113366 00000 н. 0000113537 00000 н. 0000113709 00000 н. 0000113826 00000 н. 0000113946 00000 н. 0000114087 00000 н. 0000114204 00000 н. 0000114324 00000 н. 0000114465 00000 н. 0000114663 00000 н. 0000114828 00000 н. 0000114946 00000 н. 0000115066 00000 н. 0000115207 00000 н. 0000115387 00000 н. 0000115562 00000 н. 0000115747 00000 н. 0000115865 00000 н. 0000115986 00000 н. 0000116128 00000 н. 0000116245 00000 н. 0000116365 00000 н. 0000116506 00000 н. 0000116695 00000 н. 0000116874 00000 н. 0000117057 00000 н. 0000117258 00000 н. 0000117376 00000 н. 0000117496 00000 н. 0000117638 00000 п. 0000117844 00000 н. 0000117963 00000 н. 0000118083 00000 н. 0000118224 00000 н. 0000118426 00000 н. 0000118543 00000 н. 0000118663 00000 н. 0000118804 00000 н. 0000119007 00000 н. 0000119126 00000 н. 0000119247 00000 н. 0000119389 00000 н. 0000119581 00000 п. 0000119698 00000 н. 0000119818 00000 н. 0000119959 00000 н. 0000120076 00000 н. 0000120196 00000 н. 0000120337 00000 н. 0000120455 00000 н. 0000120575 00000 н. 0000120716 00000 н. 0000120896 00000 н. 0000121064 00000 н. 0000121182 00000 н. 0000121319 00000 н. 0000121460 00000 н. 0000121626 00000 н. 0000121800 00000 н. 0000121917 00000 н. 0000122054 00000 н. 0000122195 00000 н. 0000122313 00000 н. 0000122449 00000 н. 0000122590 00000 н. 0000122773 00000 н. 0000122942 00000 н. 0000123132 00000 н. 0000123249 00000 н. 0000123386 00000 н. 0000123529 00000 н. 0000123726 00000 н. 0000123843 00000 н. 0000123980 00000 н. 0000124122 00000 н. 0000124314 00000 н. 0000124431 00000 н. 0000124568 00000 н. 0000124709 00000 н. 0000124902 00000 н. 0000125020 00000 н. 0000125156 00000 н. 0000125297 00000 н. 0000125414 00000 н. 0000125550 00000 н. 0000125691 00000 п. 0000125808 00000 н. 0000125944 00000 н. 0000126085 00000 н. 0000126293 00000 н. 0000126423 00000 н. 0000126596 00000 н. 0000126784 00000 н. 0000126993 00000 н. 0000127159 00000 н. 0000127338 00000 н. 0000127550 00000 н. 0000127675 00000 н. 0000127793 00000 н. 0000127932 00000 н. 0000128122 00000 н. 0000128237 00000 н. 0000128371 00000 н. 0000128505 00000 н. 0000128648 00000 н. 0000128802 00000 н. 0000128952 00000 н. 0000129101 00000 н. 0000129241 00000 н. 0000129432 00000 н. 0000129548 00000 н. 0000129668 00000 н. 0000129813 00000 н. 0000129955 00000 н. 0000130087 00000 н. 0000130218 00000 н. 0000130351 00000 п. 0000130482 00000 н. 0000130663 00000 н. 0000130793 00000 п. 0000130914 00000 н. 0000131041 00000 н. 0000131171 00000 н. 0000131296 00000 н. 0000131423 00000 н. 0000131550 00000 н. 0000131730 00000 н. 0000131853 00000 н. 0000131983 00000 н. 0000132182 00000 н. 0000132287 00000 н. 0000132487 00000 н. 0000132601 00000 н. 0000132720 00000 н. 0000132868 00000 н. 0000133008 00000 п. 0000133139 00000 п. 0000133270 00000 н. 0000133416 00000 н. 0000133557 00000 н. 0000133694 00000 н. 0000133839 00000 н. 0000133987 00000 н. 0000134127 00000 н. 0000134270 00000 н. 0000134418 00000 н. 0000134564 00000 н. 0000134706 00000 н. 0000134841 00000 н. 0000134974 00000 н. 0000135111 00000 п. 0000135250 00000 н. 0000135381 00000 п. 0000135530 00000 н. 0000135671 00000 н. 0000135817 00000 н. 0000135957 00000 н. 0000136087 00000 н. 0000136219 00000 н. 0000136425 00000 н. 0000136540 00000 н. 0000136696 00000 н. 0000136850 00000 н. 0000137001 00000 н. 0000137149 00000 н. 0000137313 00000 н. 0000137467 00000 н. 0000137607 00000 н. 0000137752 00000 н. 0000137895 00000 н. 0000138029 00000 н. 0000138167 00000 н. 0000138306 00000 н. 0000138417 00000 н. 0000138537 00000 н. 0000138670 00000 н. 0000138816 00000 н. 0000138965 00000 н. 0000139104 00000 н. 0000139241 00000 п. 0000139388 00000 п. 0000139531 00000 н. 0000139672 00000 н. 0000139803 00000 н. 0000139941 00000 н. 0000140071 00000 н. 0000140202 00000 н. 0000140330 00000 н. 0000140460 00000 н. 0000140595 00000 п. 0000140730 00000 н. 0000140871 00000 н. 0000141005 00000 н. 0000141156 00000 н. 0000141287 00000 н. 0000141424 00000 н. 0000141570 00000 н. 0000141717 00000 н. 0000141865 00000 н. 0000142014 00000 н. 0000142141 00000 п. 0000142269 00000 н. 0000142386 00000 п. 0000142503 00000 н. 0000142640 00000 н. 0000142772 00000 н. 0000142914 00000 н. 0000143046 00000 н. 0000143184 00000 н. 0000143366 00000 н. 0000143506 00000 н. 0000143627 00000 н. 0000143750 00000 н. 0000143891 00000 н. 0000144031 00000 н. 0000144173 00000 н. 0000144312 00000 н. 0000144506 00000 н. 0000144664 00000 н. 0000144776 00000 п. 0000144891 00000 н. 0000145055 00000 н. 0000145200 00000 н. 0000145319 00000 п. 0000145439 00000 п. 0000145600 00000 н. 0000145779 00000 н. 0000145981 00000 п. 0000146181 00000 п. 0000146321 00000 н. 0000146441 00000 н. 0000146651 00000 п. 0000146778 00000 н. 0000146903 00000 н. 0000147065 00000 н. 0000147227 00000 н. 0000147368 00000 н. 0000147507 00000 н. 0000147702 00000 н. 0000147865 00000 н. 0000148026 00000 н. 0000148138 00000 п. 0000148347 00000 н. 0000148471 00000 н. 0000148600 00000 н. 0000148758 00000 н. 0000148901 00000 н. 0000149054 00000 н. 0000149207 00000 н. 0000149371 00000 п. 0000149551 00000 п. 0000149682 00000 н. 0000149884 00000 н. 0000150032 00000 н. 0000150187 00000 н. 0000150336 00000 н. 0000150524 00000 н. 0000150682 00000 н. 0000150854 00000 н. 0000151011 00000 н. 0000151196 00000 н. 0000151323 00000 н. 0000151495 00000 н. 0000151631 00000 н. 0000151772 00000 н. 0000151917 00000 н. 0000152056 00000 н. 0000152198 00000 н. 0000152347 00000 н. 0000152509 00000 н. 0000152665 00000 н. 0000152787 00000 н. 0000152902 00000 н. 0000153092 00000 н. 0000154660 00000 н. 0000154774 00000 н. 0000154883 00000 н. 0000156174 00000 н. 0000156253 00000 н. 0000158682 00000 н. 0000160693 00000 п. 0000018367 00000 п. 0000024147 00000 п. трейлер ] >> startxref 0 %% EOF 2407 0 объект > эндобдж 2408 0 объект , ✮}? ‘W \ rZU) / U (SNOop 㴖] Z3P \ nsL) / П-12 / V 1 >> эндобдж 3289 0 объект > транслировать {N = wD $ ڝ dn / U / \ p \ gS {«

% PDF-1.3 % 16914 0 объект > эндобдж xref 16914 280 0000000016 00000 н. 0000005960 00000 н. 0000006175 00000 н. 0000006210 00000 н. 0000006268 00000 н. 0000013989 00000 п. 0000014230 00000 п. 0000014303 00000 п. 0000014525 00000 п. 0000014585 00000 п. 0000014760 00000 п. 0000014897 00000 п. 0000015057 00000 п. 0000015116 00000 п. 0000015300 00000 п. 0000015359 00000 п. 0000015543 00000 п. 0000015602 00000 п. 0000015837 00000 п. 0000015896 00000 п. 0000016103 00000 п. 0000016274 00000 п. 0000016477 00000 п. 0000016536 00000 п. 0000016797 00000 п. 0000016968 00000 п. 0000017169 00000 п. 0000017366 00000 п. 0000017599 00000 п. 0000017795 00000 п. 0000018025 00000 п. 0000018293 00000 п. 0000018462 00000 п. 0000018686 00000 п. 0000018929 00000 п. 0000019166 00000 п. 0000019404 00000 п. 0000019590 00000 п. 0000019804 00000 п. 0000020019 00000 н. 0000020078 00000 п. 0000020248 00000 п. 0000020455 00000 п. 0000020760 00000 п. 0000020977 00000 п. 0000021158 00000 п. 0000021402 00000 п. 0000021583 00000 п. 0000021756 00000 п. 0000022058 00000 п. 0000022281 00000 п. 0000022460 00000 п. 0000022712 00000 п. 0000022883 00000 п. 0000023055 00000 п. 0000023378 00000 п. 0000023575 00000 п. 0000023801 00000 п. 0000024057 00000 п. 0000024203 00000 п. 0000024358 00000 п. 0000024634 00000 п. 0000024820 00000 п. 0000025014 00000 п. 0000025271 00000 п. 0000025462 00000 п. 0000025649 00000 н. 0000025905 00000 п. 0000026090 00000 н. 0000026269 00000 п. 0000026513 00000 п. 0000026691 00000 п. 0000026922 00000 п. 0000027186 00000 п. 0000027386 00000 п. 0000027567 00000 п. 0000027834 00000 п. 0000028029 00000 п. 0000028240 00000 п. 0000028497 00000 п. 0000028685 00000 п. 0000028877 00000 п. 0000029217 00000 п. 0000029405 00000 п. 0000029629 00000 н. 0000029913 00000 н. 0000030101 00000 п. 0000030283 00000 п. 0000030577 00000 п. 0000030764 00000 п. 0000030957 00000 п. 0000031243 00000 п. 0000031433 00000 п. 0000031615 00000 п. 0000031776 00000 п. 0000031834 00000 п. 0000032019 00000 п. 0000032251 00000 п. 0000032471 00000 п. 0000032689 00000 п. 0000032841 00000 п. 0000032994 00000 н. 0000033164 00000 п. 0000033334 00000 п. 0000033504 00000 п. 0000033674 00000 п. 0000033844 00000 п. 0000034014 00000 п. 0000034184 00000 п. 0000034353 00000 п. 0000034561 00000 п. 0000034768 00000 п. 0000034970 00000 п. 0000035171 00000 п. 0000035364 00000 п. 0000035555 00000 п. 0000035749 00000 п. 0000035946 00000 п. 0000036142 00000 п. 0000036339 00000 п. 0000036534 00000 п. 0000036727 00000 н. 0000036932 00000 п. 0000037134 00000 п. 0000037335 00000 п. 0000037518 00000 п. 0000037716 00000 п. 0000037924 00000 п. 0000038121 00000 п. 0000038317 00000 п. 0000038525 00000 п. 0000038724 00000 п. 0000038935 00000 п. 0000039130 00000 н. 0000039324 00000 п. 0000039532 00000 н. 0000039761 00000 п. 0000039956 00000 н. 0000040196 00000 п. 0000040427 00000 п. 0000040625 00000 п. 0000040851 00000 п. 0000041044 00000 п. 0000041239 00000 п. 0000041479 00000 п. 0000041711 00000 п. 0000041904 00000 п. 0000042132 00000 п. 0000042324 00000 п. 0000042558 00000 н. 0000042791 00000 п. 0000043021 00000 п. 0000043216 00000 п. 0000043448 00000 п. 0000043642 00000 п. 0000043842 00000 п. 0000044052 00000 п. 0000044260 00000 п. 0000044458 00000 п. 0000044658 00000 п. 0000044858 00000 н. 0000045086 00000 п. 0000045289 00000 п. 0000045490 00000 п. 0000045681 00000 п. 0000045882 00000 п. 0000046073 00000 п. 0000046233 00000 п. 0000046437 00000 п. 0000046622 00000 н. 0000046805 00000 п. 0000047011 00000 п. 0000047199 00000 п. 0000047395 00000 п. 0000047607 00000 п. 0000047817 00000 п. 0000048018 00000 п. 0000048217 00000 н. 0000048421 00000 н. 0000048619 00000 п. 0000048831 00000 н. 0000049067 00000 н. 0000049274 00000 п. 0000049333 00000 п. 0000049392 00000 п. 0000049636 00000 п. 0000049840 00000 п. 0000050095 00000 п. 0000050333 00000 п. 0000050570 00000 п. 0000050765 00000 п. 0000050964 00000 п. 0000051164 00000 п. 0000051412 00000 п. 0000051635 00000 п. 0000051844 00000 п. 0000052051 00000 п. 0000052247 00000 п. 0000052454 00000 п. 0000052635 00000 п. 0000052830 00000 п. 0000053028 00000 п. 0000053233 00000 п. 0000053494 00000 п. 0000053726 00000 п. 0000053920 00000 п. 0000054106 00000 п. 0000054304 00000 п. 0000054504 00000 п. 0000054694 00000 п. 0000054916 00000 п. 0000055116 00000 п. 0000055359 00000 п. 0000055555 00000 п. 0000055753 00000 п. 0000055957 00000 п. 0000056179 00000 п. 0000056378 00000 п. 0000056609 00000 п. 0000056839 00000 п. 0000057052 00000 п. 0000057261 00000 п. 0000057463 00000 п. 0000057649 00000 п. 0000057888 00000 п. 0000058100 00000 н. 0000058289 00000 п. 0000058502 00000 п. 0000058711 00000 п. 0000058922 00000 п. 0000059120 00000 п. 0000059322 00000 п. 0000059508 00000 п. 0000059729 00000 п. 0000059967 00000 н. 0000060187 00000 п. 0000060448 00000 п. 0000060684 00000 п. 0000060882 00000 п. 0000061076 00000 п. 0000061286 00000 п. 0000061493 00000 п. 0000061699 00000 п. 0000061901 00000 п. 0000062109 00000 п. 0000062319 00000 п. 0000062540 00000 п. 0000062747 00000 п. 0000062958 00000 п. 0000063168 00000 п. 0000063385 00000 п. 0000063592 00000 п. 0000063812 00000 п. 0000064028 00000 п. 0000065098 00000 п. 0000065157 00000 п. 0000065378 00000 п. 0000065403 00000 п. 0000067109 00000 п. 0000067134 00000 п. 0000068685 00000 п. 0000068710 00000 п. 0000070586 00000 п. 0000070611 00000 п. 0000072166 00000 п. 0000072191 00000 п. 0000073811 00000 п. 0000073836 00000 п. 0000075503 00000 п. 0000075528 00000 п. 0000077194 00000 п. 0000077219 00000 п. 0000078290 00000 п. 0000078371 00000 п. 0000080024 00000 п. 0000122394 00000 н. 0000123205 00000 н. 0000123320 00000 н. 0000006313 00000 н. 0000013964 00000 п. трейлер ] >> startxref 0 %% EOF 16915 0 объект > эндобдж 16916 0 объект [ 16917 0 руб. ] эндобдж 16917 0 объект > / Ж 94 0 Р >> эндобдж 16918 0 объект > эндобдж 17192 0 объект > транслировать HT {TwM2L QS & b @@ D ؀ YHjDXlwzW «ZZ_NjO۳ ~ 7

% PDF-1.Y1 / żb̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3oͼ7f̛y3o | а> 0 | а> 0 | а> 0 | а> 0 | а> 0 | а> 0 | а> 0 | а> 0 | а> 0 | а> 0 | а> 0 | а> ̇0 | a ~ a ~ a ~ a ~ a ~ a ~ a ~ a ~ a ~ a ~ \ ‘su2p? Z конечный поток эндобдж 19693 0 объект > транслировать x Ekfwgw! & $! n $ (BD \ «Orx

» «99V

Глава 3: Экспрессия генов (транскрипция), синтез белков (трансляция) и регуляция экспрессии генов Карточки

Ответ — E.

Вестерн-блоттинг используется для обнаружения целевого полипептида или белка в смешанном образце. Потенциальные белки-мишени разделяют с помощью гель-электрофореза. Затем разделенные белки переносятся на нитроцеллюлозную мембрану и исследуются первичным антителом, специфичным для интересующего белка. Затем мембрану промывают и обрабатывают (вторичным) меченым антителом, которое связывается с первичным антителом и может быть обнаружено (например, с помощью колориметрии).

Например, образец сыворотки от пациента с подозрением на ВИЧ-инфекцию можно проанализировать с помощью вестерн-блоттинга для обнаружения антител, направленных против определенных вирусных белков.После разделения вирусных белков с помощью гель-электрофореза и переноса белка на нитроцеллюлозную мембрану мембрану обрабатывают сывороткой пациента. У ВИЧ-положительных пациентов могут быть антитела, которые реагируют с вирусными p24, gp41 и gp120f160. Если 2 из этих 3 полос положительные, тест считается положительным.

Вестерн-блоттинг похож на метод иммуноферментного анализа (ELISA), однако в ELISA сыворотка пациента тестируется напрямую, тогда как при вестерн-блоттинге белки сначала разделяются электрофорезом.

(Выбор B) Нозерн-блоттинг анализирует mRNillL Образец, содержащий большое количество
молекул мРНК, отделяют с помощью гель-электрофореза. Затем разделенные полосы
переносят на мембрану и гибридизуют с зондом, содержащим нуклеотидную последовательность
, комплементарную интересующей мРНК.

(Выбор C) Саузерн-блоттинг используется для анализа последовательностей ДНК. ДНК, которая фрагментирована с использованием эндонуклеаз рестрикции, разделяется гель-электрофорезом и переносится на нитроцеллюлозную мембрану.Затем для гибридизации используют ДНК-зонд с радиоактивной меткой, содержащий последовательность, комплементарную интересующей области. Мутации сайта рестрикции могут быть обнаружены с помощью саузерн-блоттинга, поскольку они изменяют длину фрагментов ДНК, тем самым изменяя характер миграции при электрофорезе.

Анализ микрочипов аналогичен саузерн-блоттингу и нозерн-блоттингу, но включает гибридизацию большого количества зондов одновременно (вариант A). Анализируемая геномная ДНК или кДНК маркируется флуоресцентной меткой и помещается на генный чип, содержащий комплементарные последовательности для большое количество генов.Степень флуоресценции соответствует мРНК, экспрессируемой в конкретном образце.

(выбор D) Юго-западный блоттинг — это методика анализа ДНК-связывающих белков с использованием принципов Саузерн-блоттинга и Вестерн-блоттинга. ДНК-связывающие белки распознаются по их способности связывать определенные олигонуклеотидные зонды.

Образовательная цель:
Вестерн-блоттинг используется для идентификации белков, Нозерн-блоттинг определяет специфические последовательности РНК, а Саузерн-блоттинг идентифицирует специфические последовательности ДНК в неизвестном образце.

Молекулярная генетика материнских клеточных делений

Цитирование: Абрамс Э. У., Фуэнтес Р., Марлоу Флорида, Кобаяши М., Чжан Х., Лу С. и др. (2020) Молекулярная генетика материнских делений клеток. PLoS Genet 16 (4): e1008652. https://doi.org/10.1371/journal.pgen.1008652

Редактор: Грегори С. Барш, Институт биотехнологии Хадсон-Альфа, США

Поступила: 8 июля 2019 г .; Одобрена: 4 февраля 2020 г .; Опубликован: 8 апреля 2020 г.

Авторские права: © 2020 Abrams et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в рукописи и ее файлах с вспомогательной информацией.

Финансирование: Авторы благодарны за следующее финансирование, Национальные институты здравоохранения: R01HD065600, R21HD094096, R35GM131908 и R01HD069321 для MCM, грант на обучение T32-HD007516 для EWA и стипендии NRSA для постдокторантов 8 5F32GMA7705F32GMA7708 5F32GMA7708 5F32GMA77 ; и постдокторские стипендии Американского онкологического общества PF-09-125-01-DDC для LK и PF-05-041-01-DDC для TG, стипендия Becas Chile в РФ и стипендия DRG1826-04 Фонда исследований рака Деймона Руньона для FLM .Спонсоры или спонсоры этого исследования не играли никакой роли в дизайне исследования, сборе и анализе данных, решении опубликовать или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

После оплодотворения новообразованная зигота подвергается клеточному расщеплению, которое находится под контролем материнских продуктов генов. Продолжительность стадии расщепления варьируется среди организмов и перемежается переходом от матери к зиготическому (MZT), в этот момент происходит активация основного зиготического генома (ZGA) (rev. [1, 2]).У рыбок данио MZT происходит во время 10-го клеточного цикла [3], тогда как у мышей MZT происходит относительно рано на двухклеточной стадии. Однако в других системах млекопитающих MZT имеет место на более поздних стадиях развития, при переходе от 4 до 8 клеток у людей [4] и при переходе от 8 до 16 клеток у кроликов и овец [5].

У некоторых позвоночных, таких как лягушки и рыбы, MZT совпадает с переходом в середину бластулы (MBT) [3, 6]. До MBT клетки делятся синхронно и не имеют промежуточных фаз разрыва во время интерфазы клеточного цикла, что обеспечивает более быстрое деление клеток.Кроме того, контрольные точки клеточного цикла отсутствуют на стадии расщепления перед MBT [3]. В MBT клеточный цикл удлиняется, становится асинхронным и, наряду с широко распространенным ZGA, инициируется миграция клеток и следуют процессы развития, такие как гаструляция и эпиболия. Поскольку генетический доступ к функциям материнских генов у позвоночных остается проблематичным, молекулярные основы стабильности генома, хромосомной архитектуры и клеточной целостности во время этих быстрых клеточных делений, лишенных контрольных точек, все еще плохо изучены.

Рыбки данио превратились в ценную молекулярно-генетическую модель для идентификации генов, важных для раннего развития позвоночных. В прошлом большинство генетических скринингов, выполняемых на рыбках данио, было сосредоточено на нацеливании на зиготические гены [7–9]. Более поздние экраны мутагенеза были разработаны для идентификации материнских генов, действующих во время раннего эмбрионального развития [10–13]. Эти начальные скрининги идентифицировали широкие категории мутаций материнского эффекта, влияющих на процессы, начиная от событий до оплодотворения, таких как полярность ооцитов [10, 14, 15], до процессов, происходящих после MBT, таких как эпиболия [13].Эти скрининги были успешными в создании коллекции мутантов с различными фенотипическими / генетическими классами, нарушающими процессы, важные для раннего развития позвоночных. Более того, эти экраны привели к открытию новых генов и новых ролей для известных генов в процессах, контролируемых матерью [16–22]. Однако стало ясно, что ожидаемые гены, такие как регуляторы клеточного цикла, не были восстановлены, что указывает на то, что экраны не достигли насыщения и что новые материнские регуляторы эмбриогенеза на стадии дробления еще предстоит открыть.

Чтобы идентифицировать гены, критические для эмбриогенеза стадии дробления, мы выполнили ENU-индуцированный скрининг мутагенеза материнского эффекта у рыбок данио. Здесь мы сообщаем о двух классах мутантов, которые нарушают стадию расщепления. Первый класс подвергается нерегулярным расщеплениям перед MBT. Второй класс подвергается задержке развития вокруг MZT и обладает различной степенью ядерных / хромосомных дефектов. О третьем классе мутантов, идентифицированных в этом скрининге, влияющих на цитокинез, сообщалось в другом месте [22].В ходе нашего скрининга мы также идентифицировали мутанта с мужской стерильностью, о котором мы также сообщаем здесь. Мы сопоставили каждую мутацию с относительно узкими генетическими интервалами. Мы позиционно клонировали мутант с остановкой развития p10umal и обнаружили, что он кодирует, Mini Chromosome Maintenance 3-like (Mcm3l), который является специфичной для матери субъединицей геликазного комплекса, действующего в лицензировании синтеза ДНК. Кроме того, мы клонировали второй мутантный ген остановки развития screeching halt ( srh ), идентифицированный в предыдущем скрининге [13], и обнаружили, что он кодирует Stem Loop Binding Protein 2 (SLBP2).SLBP связывают петлю ствола 3 ’UTR мРНК гистонов, связанных с репликацией, и участвуют в метаболизме гистонов во время S-фазы клеточного цикла [23]. Мы показываем, что гистоновые белки снижаются на стадии расщепления у мутантных эмбрионов srh и что фенотип ареста srh может быть устранен путем инъекции цельного гистонового белка, тем самым демонстрируя, что Slbp2 необходим для поддержания достаточных уровней гистонов на стадии расщепления разработка. Наши исследования идентифицируют гены материнского эффекта, которые функционируют на стадии расщепления, и для двух генов обеспечивают молекулярное понимание контролируемых матерью делений клеток в этот период развития.

Результаты и обсуждение

Идентификация мутантов на стадии расщепления

Мы провели скрининг мутагенеза ENU с материнским эффектом у рыбок данио Danio rerio и идентифицировали девять мутантов, нарушающих развитие ооцитов и / или яйцеклеток (до оплодотворения, рукопись готовится) и девять мутантов, нарушающих стадию развития расщепления (сразу после оплодотворения). ). Одна из мутаций из последней группы также вызывает фенотип мужской стерильности.Мутанты стадии расщепления в основном делятся на три класса: остановка развития, нерегулярное расщепление и мутанты цитокинеза (Таблица 1). Два мутанта цитокинеза, motley ( mot p01aiue ) и p04anua , описаны в другом месте [22]. В данном исследовании для простоты мы называем эмбрионы, полученные от гомозиготных мутантных матерей, мутантными эмбрионами.

Мы сопоставили каждую мутацию с хромосомным локусом, используя массовый сегрегантный анализ [24], демонстрируя, что каждая мутация соответствует отдельному гену (Таблица 1).Два мутанта с задержкой развития, ежевика ( bmb p22atuz , [17]) и p10umal , не подверглись эпиболии (рис. 1А), остановили свое развитие вокруг МБТ и в конечном итоге подверглись лизису до 1 через сутки после оплодотворения (dpf), аналогично кричащей остановке ( srh ) мутантам ([13]; Рис. 1A). Все три арестных мутантных фенотипа являются строго материнскими, поскольку гетерозиготные самки, скрещенные с гомозиготными самцами, дали эмбрионы дикого типа без очевидного зиготического фенотипа (таблица S1).

Рис. 1. Мутанты стадии расщепления с материнским эффектом.

A. Мутанты, задерживающие развитие, и мутанты дикого типа при 2,25 hpf (верхний ряд) и при 5,0 hpf (нижний ряд). Для каждого мутанта фенотип составляет 100% пенетрант в кладке и среди мутантных самок. Было исследовано не менее 50 эмбрионов на каждую мутантную самку (n = 233 от четырех самок srh , n = 854 от шести самок bmb , n = 335 от четырех самок p10umal ). B. Мутанты нерегулярного расщепления и дикого типа в 0.75 hpf (верхний ряд), 1.0 hpf (средний ряд) и 1.25 hpf (нижний ряд). Пять из 6 самок mxp дали показанные эмбрионы (n = 459), а одна произвела эмбрионы с более мягким фенотипом (n = 91). C. Мутанты дикого типа (верхний ряд) и cld (нижний ряд) при 1,0, 1,5 и 4,0 hpf. Проникновение фенотипа клеточного слущивания (черная стрелка) при 4,0 hpf указано в нижнем левом углу. Остальные эмбрионы сохраняют относительно нормальные, но темные бластодермы и не доживают до 24 часов после оплодотворения.

https://doi.org/10.1371/journal.pgen.1008652.g001

В трех мутантах с неправильным расщеплением смешались ( mxp p09batl ), беспорядочно ( dsy p86batl ) и p09ajug , ранние бластомеры формировали клетки с неправильным расстоянием и размером, возможно, из-за асинхронного деления клеток (Figs 1B and 6A). У эмбрионов dsy p86batl желток, по-видимому, вторгается в вышележащие бластомеры (Рис. 1B, вертикальные стрелки), а у эмбрионов mxp p09batl бластомеры постоянно уменьшаются в размерах (Рис. 1B, горизонтальные стрелки) .Мы идентифицировали еще один уникальный мутант стадии расщепления, cloudy day ( cld p40atuza ). Мутантные эмбрионы на стадии расщепления cld p40atuza были сопоставимы с эмбрионами дикого типа до стадии 1000 клеток, за исключением того, что они были намного темнее на вид в течение периода расщепления (рис. 1C). Кроме того, за пределами стадии 1000 клеток значительный процент (64%) бластулы имел клетки, отслаивающиеся от бластодермы, а сама бластодерма не имела клеточных мембран (рис. 1C).Наконец, один мутант стадии расщепления, dullahan ( dul p15uzat ), часто имел увеличенный цитоплазматический домен ниже бластодермы и через 24 часа после оплодотворения (hpf) проявлял вентрализованный фенотип (см. Ниже).

Структура ядра у мутантов

mxp и dsy

Чтобы исследовать ядерную целостность у мутантов с нерегулярным расщеплением, мы выполнили временной эксперимент, охватывающий стадии от 2 до 4 клеток, окрашивая эмбрионы с помощью DAPI и актина, чтобы маркировать ядра и границы клеток, соответственно.Ядра выглядели относительно нормальными у эмбрионов dsy p86batl (рис. 2B). В некоторых случаях наблюдались асинхронные ядерные деления (рис. 2B, 20 мин). Для сравнения, ядра в эмбрионах mxp p09batl оказались фрагментированными в каждом из бластомеров (рис. 2С). Во многих случаях деление клеток также задерживалось в этот период (рис. 2C, нижний ряд) по сравнению с делением клеток дикого типа (рис. 2A). Молекулярное клонирование каждого соответствующего гена поможет прояснить природу этих дефектов и раскрыть важную информацию о механизмах, участвующих во времени деления клеток на стадии развития расщепления.

Рис. 2. Исследование ядерной целостности в смешанных и беспорядочных эмбрионов .

A. Эмбрионы дикого типа (TL), ( B ) dsy и ( C ) mxp эмбрионы фиксировали с 5-минутными интервалами, охватывающими 20 минут (что соответствует делению клеток от 2 до 4). ) и окрашивали DAPI и фаллоидином для маркировки ДНК и актина на границах клеток соответственно. В . Репрезентативные эмбрионы (числа указаны в нижнем левом углу) от трех самок dsy .В некоторых случаях ядерные деления были асинхронными (20 мин) у эмбрионов от мутантных матерей dsy по сравнению с эмбрионами дикого типа (A). С . Репрезентативные эмбрионы (числа указаны в нижнем левом углу) от четырех самок mxp . Эмбрионы, показанные в верхнем ряду, подверглись делению клеток по времени, аналогичному дикому типу в (A), тогда как эмбрионы в нижнем ряду были отложены. Масштабные линейки = 200 мкм.

https://doi.org/10.1371/journal.pgen.1008652.g002

Ядерное деление нарушено у мутантов

p10umal

Поскольку дефект остановки развития p10umal был почти идентичен фенотипу bmb и мутанты bmb обнаруживают множественные микроядра на стадии расщепления [17], мы исследовали ядра мутантов p10umal на ранней стадии расщепления. В 8-клеточных эмбрионах p10umal только один бластомер обычно был DAPI-положительным; однако второстепенные сигналы DAPI могут быть обнаружены по крайней мере в одном дополнительном бластомере (рис. 3А).Эти ядра были меньше и фрагментированы по сравнению с зародышами дикого типа. Остальные шесть бластомеров были DAPI-отрицательными, что указывало на то, что они были безъядерными. Эти данные предполагают, что синтез ДНК и / или сегрегация ДНК дефектны у эмбрионов на стадии расщепления p10umal . Интересно, что это также показывает, что цитокинез программируется независимо от митоза во время стадии расщепления, поскольку цитокинез продолжается, хотя митоз не удается. Об этом также ранее сообщалось для бесполезного цикла ( fue ) мутантов с материнским эффектом у рыбок данио [12].

Рис. 3. Ядерное деление нарушено у мутантов p10umal .

A. Окрашивание DAPI для эмбрионов дикого типа и p10umal на 8-клеточной стадии (n = 11). Примечание: видны только четыре из 8 ячеек. B. дикого типа и C. p10umal сроки оплодотворения (обследовано N = 3 самки). Эмбрионы фиксировали при 16, 22, 25, 28, 31 и 34 м / с. Были исследованы как минимум пять эмбрионов, соответствующих каждой временной точке (показаны репрезентативные изображения).Пронуклеусы (16 mpf) и одноклеточная зигота (при 22–34 mpf) были окрашены DAPI (синий), антифосфогистоном h4 (красный) и анти-PCNA (зеленый). Масштабные линейки = 10 мкм. Временные точки 25 и 28 миль на фут были сокращены в цифровом виде на 0,5 раза. D. Схематическое изображение фенотипа p10umal в соответствующие моменты времени, иллюстрирующее типичный ДНК-мост между делящимися клетками. E. Мутанты p10umal дикого типа и p10umal при 2,5 и 3,0 hpf, окрашенные DAPI и фаллоидином для маркировки ДНК и границ клеток, соответственно.Для каждой временной точки были исследованы как минимум от 3 до 6 эмбрионов от 3 разных самок (показаны репрезентативные изображения).

https://doi.org/10.1371/journal.pgen.1008652.g003

Чтобы определить, когда во время развития дефект p10umal становится первым очевидным, мы выполнили временной график оплодотворения, охватывающий пронуклеарную конгрессу и первое митотическое деление. Мы фиксировали эмбрионы с 3-минутными интервалами, начиная с 10 минут после оплодотворения (mpf).Чтобы точно проследить митотическую прогрессию, эмбрионы окрашивали фосфогистоном h4 (фос-h4) и PCNA для маркировки митоза и интерфазы соответственно. Конгрессия пронуклеусов и первая митотическая профаза оказались нормальными у p10umal эмбрионов (сравните Рис. 3B и 3C, 16 и 22 mpf). Однако в моменты времени, соответствующие первой метафазе и анафазе, отдельные хромосомы не могли быть обнаружены в клетках p10umal . Вместо этого окрашивание фос-h4 и DAPI выявило мосты ДНК, которые охватывают и соединяют делящиеся клетки (рис. 3C, 25 и 28 mpf).Интересно, что, несмотря на эти дефекты в сегрегации ДНК, окрашивание PCNA было обнаружено в соответствующий момент времени клеточного цикла, что согласуется с отсутствием контрольных точек клеточного цикла во время стадии расщепления эмбриогенеза. Таким образом, p10umal нарушает первую метафазу эмбриогенеза.

Затем мы исследовали фенотип остановки развития на средней стадии бластулы у мутантных эмбрионов p10umal через 2,5 и 3,0 часов после оплодотворения, используя фаллоидин и окрашивание DAPI. Ячейки p10umal в 3.Эмбрионы 0 hpf выглядели похожими по размеру и форме на соответствующие эмбрионы дикого типа через 2,5 hpf, что указывает на приблизительную задержку одного клеточного цикла у мутанта (рис. 3E). Интересно, что большинство клеток p10umal были либо DAPI-отрицательными, либо содержали небольшие DAPI-положительные фрагменты. Кроме того, частые мосты ДНК присутствовали в клетках на обеих этих стадиях (рис. 3E). Таким образом, ранние дефекты сегрегации ДНК, наблюдаемые у мутантов p10umal , по-видимому, сохраняются до этих более поздних стадий.

p10umal кодирует поддерживающий белок 3-подобный минихромосоме

Чтобы определить молекулярную природу мутации p10umal , мы позиционно клонировали соответствующий ген. Изучив 253 события мейотической рекомбинации, мы сопоставили p10umal с физическим интервалом 1,1 Мб на хромосоме 20 (рис. 4A). Этот интервал фланкирован простыми полиморфными по длине последовательностями (SSLP) маркерами sc2029-2 и z43038 и содержит 12 аннотированных генов и одну предсказанную открытую рамку считывания (ORF) [25].Один ген, minichromosome maintenance protein 3-like ( mcm3l ) тесно связан с mcm3 , который является компонентом пре-инициаторного комплекса, необходимого для репликации ДНК, обнаруженного у всех эукариот (обзор [26]). Анализ последовательности кДНК яичника mcm3l от p10umal рыб выявил миссенс-мутацию (от A до C) в стартовом кодоне ATG (рис. 4A), в результате чего метионин заменяется лейцином. Следовательно, предполагается, что инициация трансляции будет нарушена, так что трансляция потенциально инициируется следующим ниже по ходу цепи метионином (Met 37 ), образуя усеченный на N-конце белок (S1 фиг.).

Рис. 4. p10umal кодирует mcm3l .

A. p10umal отображается на хромосому 20 в интервале 1,1 Мб, фланкированном sc2029-2 и z42038. Этот интервал содержит 14 предсказанных ORF (стрелки). Черная стрелка (на обратной нити) соответствует мкм3l . Геномная структура мкм3 и показана с 5 ’, ориентированным влево. Указаны оба аллеля ( p10umal и sa1624 ). Б. RT-PCR мкм3 и мкм3l в профиле развития. Этап обозначен вверху, и slbp1 используется в качестве контроля загрузки.

https://doi.org/10.1371/journal.pgen.1008652.g004

Чтобы определить, является ли нарушение функции mcm3l ответственным за фенотип p10umal , мы исследовали мутантный аллель mcm3l , идентифицированный в мутации рыбок данио. Фондовый фонд проекта (ЗМП) [27].Аллель sa1624 содержит замену T на A в положении нуклеотида 1793 ORF mcm3l . Эта мутация производит преждевременный стоп-кодон в пределах ORF, что приводит к предсказанному усечению Mcm3l по аминокислоте 591 из 807 общих остатков. Кроме того, мы обнаружили, что гомозиготные мутантные самки mcm3l sa1624 давали мутантные эмбрионы с материнским эффектом, которые задерживались на средней стадии развития бластулы, как мутантные эмбрионы p10umal , и демонстрировали такой же ядерный дефект во время расщепления.Кроме того, оба аллеля mcm3l были строго рецессивно-материнскими. Наконец, мутации sa1624 и p10umal не могут дополнять друг друга у трансгетерозиготных самок, что вызывает те же эмбриональные дефекты материнского эффекта, что и одиночные аллели (таблица S2). Эти результаты показывают, что дефекты материнского эффекта, наблюдаемые у мутантных эмбрионов p10umal и sa1624 , вызваны нарушением функции Mcm3l.

Помимо mcm3l , геном рыбок данио содержит канонический ген mcm3 , который также расположен на хромосоме 20 и более гомологичен Mcm3 млекопитающих [28].ОТ-ПЦР выявила, что экспрессия мкм3 и начинается при 3,0 hpf, что соответствует началу широко распространенной зиготической транскрипции в MBT, и сохраняется в течение 24 часов после оплодотворения (фиг. 4B). Транскрипты также могут быть обнаружены в семенниках взрослых (рис. 4В). Напротив, экспрессия мРНК мкм3 и была обнаружена на протяжении всей стадии расщепления (фиг. 4B, стадии 1 и 32 клетки, 3,0 hpf). Более низкий сигнал мкм3 / был обнаружен при 8,0 hpf, и едва обнаруживался через 24 hpf и не обнаруживался в семенниках взрослого человека (рис. 4B).Эти профили развития согласуются с исследованиями экспрессии mcm3 и mcm3l , о которых ранее сообщалось у лягушек и рыб [28], и согласуются с mcm3l , действующими по материнской линии, и mcm3 , действующими зиготически. Эти данные предполагают, что Mcm3l является специфическим для стадии расщепления компонентом гексамера Mcm, который необходим для инициации репликации ДНК. Т.о., Mcm3l функционирует внутренне во время стадии расщепления, тогда как Mcm3 функционирует зиготически на протяжении всего остального развития и у взрослых.

Наши результаты mcm3l по потере функции демонстрируют специфическую материнскую функцию для Mcm3l (гомозиготные самцы полностью нормальны). У эмбрионов p10umal сегрегация ДНК нарушена во время первого деления клетки (рис. 3C), фенотип, вероятно, связан с дефектом синтеза ДНК. Интересно, что также сообщалось, что белок Mcm3 содержит сигнал функциональной ядерной локализации, тогда как материнский Mcm3l не содержит [28]. Приобрел ли Mcm3l специфические функции на стадии расщепления, возможно, связанный с повышенной скоростью деления клеток и / или отсутствием контрольных точек, специфичных для этого периода развития, потребует будущих экспериментов по спасению p10umal с трансгеном канонического mcm3 .

Вентрализованные

дуллахан мутантные эмбрионы

Мутант на одной стадии расщепления, dullahan ( dul p15uzat ), обнаружил просвет в цитоплазматической области желтка, лежащей под краем бластодермы, у большинства эмбрионов средней бластулы (сравните фиг. 5A и 5B, 3,5 hpf). Интересно, что у большинства эмбрионов гаструлы dul p15uzat щит, который отмечает предполагаемую спинную область и является эквивалентом спинного организатора у рыбок данио, был либо значительно уменьшен, либо не образовался (рис. 5A и 5B, 5 .5 л.с.в). К 24 часам после оплодотворения большая часть эмбрионов dul была вентрализована в различной степени или подверглась лизису (рис. 5A – 5C).

Рис. 5. dullahan мутантный фенотип.

A. Эмбрионы дикого типа и ( B ) dul в возрасте 3,5, 5,5 и 24 часов оплодотворения. Эмбрионы на верхней левой и центральной панелях представляют собой виды сбоку, а верхние правые панели — это виды на анимальный полюс. Увеличенная цитоплазматическая область между желтком и бластомерами у мутанта dullahan на 3.5 hpf отмечены звездочками. Спинной щит (стрелка) находится справа у эмбриона дикого типа 5.5 hpf и отсутствует у мутанта. C. Распределение эмбриональных фенотипов от пяти самок dul (слева) по сравнению с 6 братьями и сестрами (справа): mut # 1 (n = 80), mut # 2 (n = 71), mut # 5 (n = 68) ), mut # 6 (n = 32), mut # 7 (n = 105), HET-A (n = 103), HET-B (n = 112), HET-C (n = 76), HET-D (n = 76), HET-A (n = 67), HET-A (n = 118), HET-G (n = 32). В каждом скрещивании гетерозиготных или мутантных самок скрещивали с самцами дикого типа (TL).

https://doi.org/10.1371/journal.pgen.1008652.g005

Чтобы исследовать вентрализацию эмбрионов dul , мы исследовали экспрессию двух маркеров спецификации дорсальной ткани. Ген антагониста BMP chordin ( chd ) экспрессируется в дорсальной гаструле и ингибирует вентрализующую активность BMP [29, 30]. Мы также исследовали экспрессию goosecoid ( gsc ), маркер эмбрионального щита (дорсальный организатор) [31].У эмбрионов на стадии ранней и средней гаструлы (6.0 и 8.0 hpf соответственно) экспрессия chd либо отсутствовала, либо снижалась у эмбрионов dul (Фиг.6A и 6B ’). В большинстве эмбрионов dul экспрессия gsc полностью отсутствовала или была снижена (фиг. 6C и 6D ’). Эти результаты показывают, что спецификация дорсальной ткани серьезно нарушена у эмбрионов dul . Поскольку край, отделяющий бластодерму от желточной клетки, значительно увеличен у эмбрионов dul , возможно, что дорсальные детерминанты, происходящие из вегетативной области и активирующие сигнальный путь Wnt / β-Catenin для установления дорсального организатора [21], являются затруднены в их окончательном транспорте в спинную область, что приводит к вентрализации.

Рис. 6. Дорсальные маркеры уменьшены у мутантов dullahan .

экспрессия мРНК хордина в эмбрионах дикого типа ( A, A ’) и dul ( B, B’ ) через 6,0 и 8,0 часов оплодотворения соответственно. A и A ’- виды животных, сверху справа. B и B ’- виды сверху. Количество эмбрионов с показанным паттерном экспрессии всех исследованных эмбрионов указано в верхнем правом или левом (вставка) углу. goosecoid, экспрессия мРНК в эмбрионах дикого типа ( C, C ’) и dul ( D, D’ ) в 6.0 и 8.0 hpf соответственно. Цифры в правом нижнем углу указывают количество эмбрионов с любым положительным сигналом гусекоид от общего числа исследованных эмбрионов.

https://doi.org/10.1371/journal.pgen.1008652.g006

p09ajug — аллель поло-подобной киназы-1

В нашем скрининге мутантов с материнским эффектом мы идентифицировали дополнительный мутант нерегулярного расщепления, который напоминал , смешанный с и disarray , названный p09ajug (рис. 7A).Внутри этой мутантной линии мы также идентифицировали фенотип с высокой пенетрантностью мужской стерильности (рис. 7D). Мы картировали мутацию p09ajug с мужской стерильностью с использованием анализа массовой сегрегации на хромосому 1 между маркерами SSLP z11369 и z7573. Мутация с материнским эффектом отображена в одном и том же месте, что позволяет предположить, что оба фенотипа были вызваны одной и той же мутацией. Однако через несколько поколений мы больше не идентифицировали гомозиготных самок мутанта p09ajug , и все гомозиготы были самцами, что позволяет предположить их роль в половой дифференциации самок.Дальнейшее точное картирование сузило p09ajug до интервала 700 т.п.н. на хромосоме 1 (1370 мейотических событий; фиг. 7B). Не было обнаружено генетических рекомбинантов в SSLP BX004779-2, который находится на 114 т.п.н. выше гена polo-like kinase 1 ( plk1 ) (фиг. 7B).

Рис. 7. p09ajug является аллелем поло-подобной киназы-1 .

A. Эмбрионы самок мутанта p09ajug демонстрируют фенотип нерегулярного дробления. B. Мутация p09ajug отображается на хромосоме 1 в интервале 700 т.п.н., фланкированном маркерами SSLP, CU467110 и CU104756-4. C. Геномная структура plk1 , указывающая изменение T на G в стартовом кодоне. D. Гомозиготный p09ajug мужскую стерильность можно исправить с помощью Tg (actb2 : plk1) . Каждая полоса представляет собой отдельную рыбу, где M = самец, а F = самка. Первое число в названии рыбы (6-, 4-, 5-) обозначает конкретное семейство рыб, за которым следует идентификационная информация об отдельной рыбе. Общее количество оцениваемых эмбрионов указано вверху каждой полосы.

https://doi.org/10.1371/journal.pgen.1008652.g007

Секвенирование кДНК plk1 , полученной из ткани яичника p09ajug , выявило миссенс-мутацию T в G в стартовом кодоне ATG в AGG (рис. 7C). Ожидается, что потеря инициирующего метионина приведет к инициации трансляции в следующем нижестоящем ATG (Met 36 ) в том же экзоне, что приведет к амино-усеченному белку Plk1 p09ajug . Зиготические нулевые аллели plk1 обнаруживают раннюю эмбриональную летальность [32, 33].Таким образом, мы постулируем, что аллель plk1 p09ajug является гипоморфной мутацией, которая обеспечивает достаточную зиготическую активность, но недостаточную функцию для мужской фертильности и материнской регуляции стадии расщепления. Интересно, что выравнивание N-конца гомологов PLK1 позвоночных указывает на относительно низкую консервацию по сравнению с большинством других областей белка (S2 фиг.).

Для дальнейшего исследования, соответствует ли p09ajug plk1 , мы создали трансген с промотором beta-actin2 , управляющим экспрессией plk1 ( Tg (actb2 : plk1) ) в мутанте p09ajug . фон.Чтобы облегчить идентификацию носителей, трансгенный вектор также экспрессирует GFP под сердечным промотором, генерируя эмбрионы с зеленым сердцем. Гомозиготные самцы и самки с мутантом p09ajug , содержащие трансген plk1 , были фертильными (рис. 7D), а самки дали все нормальное потомство, что указывает на то, что Tg (actb2 : plk1) может спасти p09ajug с мужской стерильностью, материнской стерильностью. эффект и фенотипы женского развития. В целом эти эксперименты демонстрируют, что p09ajug является гипоморфным аллелем plk1 .

Plk1 участвует в созревании центросомы и играет важную роль в обеспечении перехода клеточного цикла G2 в M посредством активации Cdc25A phosphatase (rev. [34]). Интересно, что исследование с использованием химического ингибирования BI 2536 Plk1 продемонстрировало, что Plk1 необходим для первого митотического деления в эмбрионе мыши [35]. Кроме того, потеря функции plk1 в C . elegans выявил дефект в объединении материнского и отцовского геномов в процессе оплодотворения, что привело к фенотипу «парных ядер» [36].Удивительно, но этот фенотип сохранялся в последующих митотических делениях во время раннего эмбриогенеза [36]. Более поздние исследования продемонстрировали, что Plk1 дикого типа необходим для образования нового трехстороннего мембранного соединения, которое способствует слиянию пронуклеусов в C . elegans [37]. Интересно, что эта структура обычно не формируется во время последующего соматического деления у эмбрионов дикого типа, что объясняет сохранение двойных ядер у термочувствительных мутантов plk1 [37].В будущем будет интересно изучить возможную роль plk1 во время объединения родительского генома при оплодотворении у рыбок данио. Однако аналогичная роль, вероятно, будет механистически отличной, поскольку слияние кариомерных мембран участвует во время раннего развития рыбок данио, которое нуждается в материнском Bmb белке [17]. Более того, соответствующий гомолог Bmb, по-видимому, отсутствует в C . elegans геном [37, 38].

Визжащая остановка кодирует белок, связывающий стеблевую петлю 2

Затем мы исследовали молекулярную природу мутантного гена screeching halt ( srh p18ad ), который вызывает фенотип, сходный с фенотипом остановки средней бластулы с мутацией mcm3l с материнским эффектом, p10umal .Чтобы определить молекулярную природу дефекта srh , мы позиционно клонировали соответствующий мутантный ген. Мы исследовали 1003 мейоза и сопоставили srh с интервалом 600 т.п.н. на хромосоме 21 (рис. 8А). Частота мейотической рекомбинации фланкирующих маркеров предсказывает, что мутация находится в третьем генетическом интервале, ближайшем к zBX510945 (рис. 8A). Анализ последовательности генов в этой области выявил изменение основания T на A в связывающем домене РНК, кодируемом в гене , связывающего петлю стволовой петли 2 ( slbp2 ), что привело к замене консервативного изолейцина на аспарагин (фиг. 8A и 8D).

Рис. 8. Визг-остановка кодирует SLBP2.

A. Мутация srh отображается на интервал 600 т.п.н. на хромосоме 21, фланкированной zBX510945 и zBX511168. Рекомбинанты, идентифицированные между мутацией и маркером по общему количеству исследованных мейотических событий, отмечены красным цветом под каждым маркером. Интервал содержит 21 предсказанную ORF (стрелки). Черная стрелка (на обратной нити) соответствует slbp2 . Предполагаемая структура экзон-интрон указана ниже.Примечание: интрон 3 (568 п.н.) и интрон 5 (1961 п.н.) не масштабированы (пунктирные линии) из-за размера. Мутации, соответствующие srh p18ad (T to A, Iln to Asn) и srh sa12562 (C to T, Glu to stop) отображаются на экзон 4. B. sa25162 Аллель не может дополнять srh p18ad . Эмбрионы от самок sa25162 / + и десяти трансгетерозиготных самок p18ad / sa25162 , по крайней мере, 50 эмбрионов на самку (n = 880), показано через 6 часов после оплодотворения. C. ОТ-ПЦР slbp2 (вверху) и slbp1 (внизу) из кДНК дикого типа (стадия яичника, 32 клеток и сфера). D. RBD SLBP рыбок данио (zSLBP1 и zSLBP2), Xenopus (xSLBP1 и xSLBP2) и крупного рогатого скота (bSLBP1 и bSLBP2) были сопоставлены с использованием Clustal Omega [53]. Остаток Iln, который мутирован в Asn в srh p18ad , и остаток Glu, который мутирован в стоп-кодон в slbp2 sa12562 , выделены красным.«*» Указывает на идентичные остатки, «:» или «.» Указывает на аналогичные остатки.

https://doi.org/10.1371/journal.pgen.1008652.g008

Поскольку мутация srh кодирует миссенс-изменение Ile в Asp, мы попытались проверить, действительно ли это поражение нарушает функцию SLBP2. Поиск в коллекции ZMP выявил аллелей slbp2 , содержащих преждевременные стоп-кодоны [27]. Один такой аллель, sa25162 , содержит замену пары оснований C на T в нуклеотиде 469 ORF, превращая Gln 157 в стоп-кодон (Фиг.8A и 8C).Были получены трансгетерозиготные самки и исследовано их потомство. Как и ожидалось, аллель slbp2 sa25162 не смог дополнить srh p18ad , и 100% мутантных эмбрионов проявили фенотип остановки развития средней бластулы (рис. 8B; n = 880 из 10 трансгенных клеток). -гетерозиготные самки). Это демонстрирует, что фенотип srh обусловлен дефектом функции Slbp2.

Родственный белок SLBP1 действует в процессинге и стабилизации транскриптов гистонов и способствует трансляции гистоновых белков, производство которых строго регулируется прогрессированием клеточного цикла и репликацией ДНК (rev. [39]).SLBP1 ассоциируется со специализированной структурой петли стержня, расположенной в 3 ’UTR мРНК коровых гистонов. Его роль аналогична роли связывающего поли-А белка, который стабилизирует и способствует трансляции транскриптов мРНК, содержащих поли-А. Slbp2 МРНК экспрессируется в основном в яичниках лягушек [40] и некоторых млекопитающих [41]. Было высказано предположение, что SLBP2 у крупного рогатого скота может накапливать значительный запас мРНК гистона в ооците для последующего расщепления оплодотворенной яйцеклетки [42]. Поскольку домены активации трансляции и процессинга РНК не консервативны в SLBP2 (S3 фиг.), Это может быть достигнуто за счет стабилизации SLBP2 и предотвращения транскрипции основных гистоновых транскриптов во время оогенеза.У Xenopus постулируется, что впоследствии, во время активации яйца, SLBP2 деградирует, позволяя SLBP1 связываться с петлей ствола 3 ’UTR, чтобы способствовать процессингу мРНК и трансляции корового гистона [40].

Мы исследовали экспрессию мРНК slbp2 и slbp1 в яичнике и во время раннего развития рыбок данио. ОТ-ПЦР выявила экспрессию slbp2 в яичнике на стадии расщепления и через 4 hpf (стадия сферы), после стадии MBT (фиг. 8C). Для сравнения, экспрессия slbp1 и была обнаружена на всех соответствующих стадиях (Рис. 8C), что согласуется с предыдущими данными, которые также показали экспрессию slbp1 , но не slbp2 на более поздних эмбриональных и личиночных стадиях [43, 44].Потеря зиготической функции Slbp1 у рыбок данио ведет к нормальному раннему эмбриональному развитию, но вызывает дефекты развития сетчатки на 2 dpf, в дополнение к другим морфологическим дефектам на 3 dpf [44]. Т.о., хотя slbp2 и slbp1 коэкспрессируются в яичниках и во время ранней стадии расщепления, они проявляют отчетливые дефекты развития.

Затем мы исследовали, влияет ли нарушение функции Slbp2 на уровни материнского гистонового белка во время раннего развития.Белковые экстракты получали из эмбрионов, полученных на стадиях от 8 клеток до 3,5 hpf от самок дикого типа и srh p18ad , и использовали для вестерн-блоттинга. Антитела, которые специфически распознают каждый из ядерных гистонов, показали, что h3A и h3B почти полностью отсутствовали в эмбриональных экстрактах srh по сравнению с экстрактами дикого типа на каждой тестируемой стадии, в то время как h4 и h5 были заметно уменьшены (рис. 9A; S4C и S4D, рис. ). Мы также исследовали уровни гистонов в неоплодотворенных яйцах.Как и в эмбриональных экстрактах, уровни h3B были значительно снижены в неоплодотворенных яйцах, однако уровни h4 и h5 не были значительно снижены (S4A и S4B, фиг.). Эти результаты указывают на то, что Slbp2 функционирует в производстве уровней корового гистонового белка, которые действуют во время контролируемых матерью стадий расщепления. Поскольку Slbp1 экспрессируется как в материнский, так и в зиготический периоды (рис. 8C), низкие уровни ядер гистонов, остающиеся в экстрактах, полученных из srh , могут быть продуктами активности Slbp1. Кроме того, антитело против h4 может также распознавать варианты гистонов, такие как h4.3, которые являются полиаденилированными и не требуют активности SLBP для экспрессии (т.е. не имеют петли ствола 3 ’UTR). Это также может способствовать низким уровням h4, все еще обнаруживаемым у мутантов srh .

Рис. 9. Slbp2 необходим для продукции гистонов во время раннего развития.

A. Вестерн-блоттинг четырех ядерных гистонов в эмбрионах дикого типа и srh . Анти-α-тубулин использовали в качестве контроля нагрузки. B. Фенотип остановки развития srh может быть устранен путем инъекции общего гистонового белка в одноклеточные эмбрионы srh .P-значения были определены с использованием t-критерия Стьюдента. **** p <0,0001. srh эмбрионы инъецировали 5 нг ( C E ) или 7,5 нг ( F I ) цельного гистона. C и F , изображения сбоку при 5 hpf. Виды сбоку D и G при 6 hpf. E и H были получены при 24 hpf. I был получен при 48 hpf. Обратите внимание на формирование головы и пигментацию глаз в H и присутствие меланоцитов в I .

https://doi.org/10.1371/journal.pgen.1008652.g009

Чтобы определить, вызывает ли снижение гистоновых белков фенотип остановки развития srh , мы вводили в одноклеточные эмбрионы srh целые гистоны, полученные из тимуса теленка, которые содержат все четыре основных гистона. Неинъектированные эмбрионы или эмбрионы srh , которым инъецировали 3,5 нг цельных гистонов, никогда не инициировали эпиболию (рис. 9В). Напротив, значительной части эмбрионов вводят 5 или 7.5 нг цельных гистонов инициировали эпиболию и выжили до 1 dpf. Примечательно, что некоторые из них выжили до 2 dpf (рис. 9B – 9I). Эти данные указывают на то, что мутанты srh испытывают дефицит продукции гистоновых белков, что приводит к остановке их развития на средней стадии бластулы.

Интересно, что нокдаун SLBP в ооцитах трансгенных мышей dsRNA также ведет к ранней остановке развития, и фенотип восстанавливается путем инъекции гистонового белка [45]. Недавно He et al. Применили подход обратной генетики для изучения функции SLBP2 рыбок данио путем генерации инделевых аллелей с использованием CRISPR-Cas9 [43].Интересно, что они продемонстрировали частичное восстановление фенотипа хроматина у арестованных эмбрионов (также описанное у мутантов srh , [13]) путем введения трансгена h3B в мутантный фон. Однако пополнение h3B не смогло спасти фенотип остановки развития, указывая на то, что необходим по крайней мере еще один ядерный гистон, который действительно был предоставлен в наших экспериментах по спасению.

Подобно SLBP1, РНК-связывающий домен (RBD) SLBP2 рыбок данио является высококонсервативным для гомологов лягушек и млекопитающих (фиг. 8D).Однако за пределами RBD последовательность гораздо менее консервативна (S3 фиг.). Более того, у рыбок данио, быков и лягушек SLBP2 регионы, важные для активации трансляции [46] и процессинга РНК [47], не консервативны (S3 Fig). Таким образом, возможно, что SLBP2 служит для поддержания и стабилизации транскриптов материнских гистонов и предотвращения трансляции мРНК коровых гистонов, как предполагалось ранее [40, 41]. Действительно, He et al. показали сильное сокращение транскриптов коровых гистоновых белков, h3a , h3b , h4 и h5 , на стадии яичников и расщепления материнских мутантов рыбок данио slbp2 [43].Неожиданно, однако, мы обнаружили незначительное или полное отсутствие снижения белков h4 и h5 в неоплодотворенных яйцах, хотя явное снижение было очевидным на более поздних стадиях расщепления (фиг. 9A и S4, фиг.). Поскольку белок SLBP2 присутствует на протяжении всего оогенеза и на стадии расщепления, он может быть замещен SLBP1, чтобы обеспечить продукцию корового гистона мРНК материнского гистона или функционировать вместе с другими белками, опосредуя их трансляцию. Наши данные согласуются с этой моделью, поскольку отсутствие материнского SLBP2 может приводить к снижению стабильности мРНК гистонов и, как следствие, снижению уровней материнских ядер гистонов.Этот регуляторный механизм важен для поддержания оптимального уровня ядер гистонов во время расщепления, поскольку избыток или дефицит гистонов может нарушить нормальное развитие MBT (см. Ниже).

Не следует полностью исключать возможность того, что SLBP2 играет более прямую роль в продукции гистонов. Эксперименты по нокдауну трансгенной dsRNA на мышах показали, что функциональный SLBP необходим для накопления гистонов h4 и h5, но не для накопления h3A или h3B в ооците мыши [45]. У мышей имеется только одна функциональная копия Slbp , которая наиболее гомологична Slbp1 , а Slbp2 вместо этого является псевдогеном у мышей [41].Наши данные показывают, что Slbp2 требуется для накопления h3A и h3B и в меньшей степени накопления h4 и h5 (рис. 9A и S4, рис.). Это в сочетании с присутствием мРНК slbp1 и в ооците (рис. 8C) повышает вероятность того, что Slbp1 рыбок данио может увеличивать продукцию h4 и h5, как это имеет место в случае SLBP у мышей. Следует отметить, что белок Slbp2 рыбок данио (326 остатков) намного больше, чем его аналоги bSLBP2 (152 остатка) или xSlbp2 (250 остатков) (S3 на фиг.). Остается определить, находится ли какая-либо активация трансляции и / или связанная с процессингом РНК активность в этих неопределенных областях Slbp2 рыбок данио.

Недавно было продемонстрировано, что снижение или увеличение эндогенных уровней материнских гистонов может приводить к преждевременному или отсроченному ZGA, соответственно [48, 49]. Действительно, три из семи протестированных зиготических генов не экспрессировались у мутантов srh [13]. Необходимы дальнейшие эксперименты, чтобы выяснить, в какой степени ZGA поражается у srh мутантных эмбрионов и в какой степени концентрация материнского гистона играет роль в продвижении MBT.

Мутанты, арестовывающие среднюю бластулу

Здесь мы определили молекулярную природу двух мутантных генов с материнским эффектом, которые вызывают задержку развития проксимальнее MBT и кодируют специфические для матери белки, важные для развития клеточного цикла.Эти два мутанта с задержкой развития вместе с третьим, идентифицированным нами ранее, ежевика , все арестовываются на одной и той же стадии средней бластулы, но при этом имеют очень отчетливые клеточные дефекты и кодируют различные факторы (Mcm3l, фактор инициации репликации ДНК; Slbp2 регулирует гистон). продукция белка; Brambleberry регулирует слияние ядерных кариомеров [17]). На этой стадии может быть контрольная точка развития, которая вызывает арест, или, альтернативно, каждый мутант может аналогичным образом не экспрессировать ключевой зиготический ген (ы), необходимый для инициации дальнейшего развития.Последнее согласуется с тем, что подобная стадия остановки развития вызывается ингибированием полной транскрипции обработкой актиномицином D [50]. Требуются дальнейшие исследования, чтобы различить эти возможности.

Таким образом, мы выполнили скрининг химически индуцированного мутагенеза и охарактеризовали 9 мутантов с материнским эффектом с дефектами в различных аспектах стадии развития расщепления. Все соответствующие мутации были сопоставлены с относительно узкими генетическими интервалами (таблица 1), и несколько мутантных генов были клонированы.Наш молекулярно-генетический подход выявил критические материнские факторы, а также гипоморфный аллель фактора более широкого действия ( plk1 ), который функционирует на стадии расщепления в развитии. Наше исследование также предоставляет новые мутанты с материнским эффектом, которые, как ожидается, помогут в выяснении молекулярных механизмов, регулирующих клеточное деление необычно больших бластомеров во время стадии расщепления без контрольных точек в развитии позвоночных.

Материалы и методы

Заявление об этике

Это исследование было одобрено Комитетом Институционального ухода и использования животных Пенсильванского университета (IACUC).

Рыбные запасы

Следующие запасы мутантов были получены посредством крупномасштабного скрининга мутагенеза ENU: p04anua , p01aiue , p40atuz , p09ajug , p15uzat , p86batl , p09uzatl al, p10 . srh p18ad сообщается в [13]. Версия 9 сборки генома рыбок данио (Zv9) была использована для анализа сцепления для определения положения на хромосомной карте соответствующих мутантных аллелей.Все образцы дикого типа, использованные в экспериментах, были Tupfel long fin (TL) или соответствующими братьями и сестрами мутантных аллелей. Штаммы мутантных аллелей mcm3l sa1624 и slbp2 sa25162 были получены из проекта мутации рыбок данио [27]. Аллели p22atuz , p18ad , p10umal , p09ajug и mcm3l sa1624 были генотипированы с использованием системы генотипирования конкурентной аллель-специфической ПЦР от KBiosciences (KASP, KBiosciences).Следующие последовательности были отправлены в KBiosciences для создания соответствующих аналитических смесей: p22atuz : 5’-CAATGGTTTACATGCGTTTATCAACTCTGCTAATACTGTCATGTG CTNNT (A / T) GAGAATGTTAGCGGGCAGGAAGGATCAGACCGCGCGGGCAGGAAGGATCAGACCGCG;

p18ad : 5’- TCTCATTTGAGATCAATGAGGCTGTTTTGAAGCGTAGGCAAAAGCAG A (A / T) TCAGTATGGGAAGAATACCTGTGGCTACCAGAACTACGTTCAGCAGGTTC-3 ’;

p10umal : ATTTTAAATATTGTAATGCACATGCTGATGCGCGTGTAGGAGAA [A / C] TGG ATACTGGGTTAGAGGACCTCGAGCTGAGAGAGTCACAGAGGGAATATC; p09ajug : 5’-GGACGTTAGGGTGTATTTTGTACTTAAGAGCATTTGTAGTGTACAACGA [T / G] GAGTGCTGCAATTGCAAAGCCATCGGCGAAGCCATCGGCTCACGTCGAT-3 ’.Последовательности mcm3l sa1624 и slbp2 sa25162 были получены из центра Sanger (sanger.ac.uk). Аллель plk1 p09ajug также был генотипирован с использованием производных расщепленных амплифицированных полиморфных последовательностей (dCAPS). Следующие наборы праймеров были использованы для создания ампликона длиной 162 п.н.: dCAP-plk1-F1: 5’-TAAGAGCATTTGTAGTGTAC AtCGA -3 ’; dCAP-plk1-R1: 5’-CCCAAAAAGCGACC TCTCATGTATC-3 ’.Выделенные жирным шрифтом нуклеотиды соответствуют частичному сайту рестрикции Cla-1, который генерируется в геномной ДНК дикого типа (ATCGAT) и разрушается в мутантной ДНК (ATCGA G ). Строчная буква t была встроена в праймер для создания частичного сайта Cla1. Полученный ампликон длиной 162 п.о. расщепляли с помощью ClaI с получением фрагментов 142 и 20 п.н. в ДНК дикого типа, которые разделяли и визуализировали на 2% -ном агарозном геле LE.

Окрашивание антител целиком и гибридизация in situ

Для курсов оплодотворения эмбрионы собирали при 10 м / с (контролируемое спаривание) и фиксировали с 3-минутными интервалами в 4% параформальдегиде / PBS (PFA) в течение ночи.Иммунофлуоресценцию, окрашивание DAPI и конфокальную визуализацию проводили, как описано ранее [17], с использованием следующих антител: PCNA (1: 500, Abcam; Ab-29), фосфогистон h4 (1: 200, Millipore Sigma; 06–570). Полную гибридизацию монтировки in situ с проводили, как сообщалось ранее [20].

Хромосомное картирование мутаций материнского эффекта и позиционное клонирование

p10umal и srh

Мутанты были картированы с использованием анализа групповой сегрегации [24].Самый близкий связанный SSLP с каждой мутацией приведен в таблице 1. SSLP, разработанные для точного картирования p10umal , p09ajug и srh p18ad , перечислены в таблице S3. Полные ORF мкм3l и slbp2 были амплифицированы с помощью RT-PCR с использованием следующих наборов праймеров: мкм3l -ORF (для) -5′-GCTTGGTTTTGGTTGCTTCAT-3 ‘, мкм3l -ORF (rev) -5′ — ATGAGAAACACCACATCCT CTG-3 ‘и slbp2 -ORF (для) -5′-GCCAAAATCATG ACAACACG-3′ и slbp2 -ORF (rev) -5′- TCAAAATCTCGAAGGCTGCT-3 ‘.Продукты ПЦР секвенировали на обеих цепях с помощью средства секвенирования ДНК Университета Пенсильвании.

Transgene, Tg (

actb2: plk1 ), поколение

ORF pkl1 была амплифицирована из кДНК семенников с использованием следующих пар праймеров: plk1-pentr-F1- 5′-CACCATGAGTGCTGCAATTGCAAAGCC-3 ‘и plk1-pentr-R1-5′-TTAGCTGTGCTGAAGTAGCA и затем в pentr -TOPO (Invitrogen) для создания среднего входного клона, который впоследствии был клонирован в pDestTol2CG2 (содержащий кассету GFP легкой цепи сердечного миозина) [51] вместе с 5’-входным клоном, содержащим промотор бета-актина [52] и 3′-входной клон polyA с использованием технологии клонирования Gateway (Invitrogen).25 мкг ДНК pDestTol2CG2B-actin- plk1 вместе с 25 мкг мРНК транспозазы Tol2 [51] инъецировали в цитоплазму эмбрионов на одноклеточной стадии, полученных от гетерозиготной самки p09ajug , скрещенной с гетерозиготным самцом 09ajug . Рыбы-основатели были идентифицированы путем скрининга их соответствующего потомства на сердечный GFP. Рыба-основатель p09ajug (- / +) впоследствии была скрещена с p09aug с получением гомозиготной и гетерозиготной рыбы F1 p09ajug , несущей трансген, Tg (actb2 : plk1) .Трансген разделяется по менделевской манере через несколько поколений, то есть при ауткроссинге 50% потомства наследуют трансген, на что указывает зеленая флуоресценция в сердце и генотипирование трансгена, что указывает на то, что это вставка одного трансгена.

ОТ-ПЦР

РНК

получали из яичников или эмбрионов указанных стадий с использованием реагента Trizol (Invitrogen) в соответствии с инструкциями производителя. кДНК генерировали с использованием обратной транскриптазы Superscript II (Invitrogen) в соответствии с инструкциями производителя.Для обнаружения транскриптов мкм3 и использовали следующие пары праймеров: мкм3 (для) -5’- GGAAGAGGAGCTCCAGGTTT-3 ’, мкм3 (перес.) -5’-AATCAAACCCACCGACTGAG-3’. Следующие праймеры были использованы для обнаружения мкм3,1 : мкм3,1 (для) -5’-AAGCTGGTGA AGCCAGTGTT-3 ’, мкм3,1 (изм.) -5’-ATGAGAAACACC ACATCCTCTG-3’. Следующие пары праймеров были использованы для обнаружения slbp1 и slbp2 : slbp1 (для) -5′-GATGAGGTGGAGGAACAGGA-3 ‘, slbp1 (rev) -5′- TTGATGAGCATTGGGATTCA-3′, slbp для) -5′-GCCAAAATCATGACAACACG-3 ‘и slbp2 (rev) -5′ CAAGCAAGCTCTGCAGT TGA-3 ‘.

Вестерн-блоттинг

Эмбрионы подвергали дехорионированию, бластодермы вручную извлекали из желтка с помощью щипцов и мгновенно замораживали в жидком азоте. В каждом эксперименте было проанализировано одинаковое количество эмбрионов для каждой стадии развития. Для флуоресцентного вестерн-блоттинга образцы кипятили в загрузочном буфере SDS при 98 ° C в течение 10 минут и прогоняли на 4–12% полиакриламидных гелях NuPAGE Bis-Tris (NP0321BOX; ThermoFisher Scientific). Белки наносили на нитроцеллюлозную мембрану с использованием буфера для переноса (15% метанол) при 220 мА в течение 75 мин.5% молоко / TBS использовали для блокирования мембран в течение 1 часа при комнатной температуре или в течение ночи при 4 ° C. Первичные антитела инкубировали в течение 1 часа при комнатной температуре или в течение ночи при 4 ° C. Вторичные антитела инкубировали 45 мин при комнатной температуре. 5% молоко / TBS-Tween использовали для растворения первичных и вторичных антител. Между инкубациями проводили промывание в TBS-Tween. Перед обнаружением мембраны сначала промывали TBS-Tween, затем обессоливали в воде, погружали в метанол и давали высохнуть на воздухе. Мембраны анализировали на системе инфракрасной визуализации Odyssey (LI-COR).В качестве контроля нагрузки α-тубулин исследовали визуально на всех блотах. Антитела к гистонам были получены от Abcam (Кембридж, Массачусетс). Анти-h3A (ab18255; 1: 1000), анти-h5 (ab10158; 1: 1000), анти-h3B (ab1790; 1: 3000) и анти-h4 (ab1791; 1: 10 000) были основными антителами, используемыми для вестерн промокание. Анти-α-тубулин (Sigma, T6074) использовали в качестве контроля нагрузки (1:20 000). Были исследованы три биологические повторы.

Для количественной оценки вестернов содержание гистонов в данном образце было нормализовано к тубулину, а затем вычислен масштабный коэффициент на основе анализа образца дикого типа на той же мембране (так что дикому типу всегда присваивалось значение, равное единице).Для каждого лечения мы выполнили тест линейной модели (ANOVA) с масштабированной концентрацией как функцией белка, генотипа и взаимодействия между ними, чтобы определить важные условия взаимодействия. Наконец, мы выполнили апостериорный тест диапазона Тьюки, чтобы сгенерировать P-значения для каждого конкретного контраста, представленного на S4 рис.

.

Микроинъекции гистона

Всего 3,5 нг, 5 нг или 7,5 нг цельных гистонов (Sigma H9250) вводили в одноклеточные эмбрионы, полученные от матерей дикого типа или мутантных матерей srh .Эмбрионы исследовали через 5, 6, 24 и 48 часов после оплодотворения для анализа на спасение.

Руководство по программированию Lenovo Network REST API для операционной системы Lenovo Cloud Network 10.6

% PDF-1.7 % 8119 0 объект > эндобдж 8118 0 объект > поток 2017-12-15T11: 16: 45ZFrameMaker 10.0.22017-12-15T11: 39: 11 + 02: 002017-12-15T11: 39: 11 + 02: 00Acrobat Distiller 10.1.13 (Windows) Lenovo 2017application / pdf

  • Lenovo Network Руководство по программированию REST API для сетевой операционной системы Lenovo Cloud 10.6
  • Lenovo
  • Lenovo 2017uuid: 84f0d4cf-587d-4c41-9183-0cf5049f4956uuid: 436a651c-78ca-4033-b8c7-2b5ae850b765 конечный поток эндобдж 8117 0 объект > эндобдж 8049 0 объект > эндобдж 8048 0 объект > эндобдж 1821 0 объект > эндобдж 835 0 объект > эндобдж 1918 0 объект > эндобдж 3019 0 объект > эндобдж 3953 0 объект > эндобдж 4956 0 объект > эндобдж 5915 0 объект > эндобдж 7885 0 объект > эндобдж 6731 0 объект > эндобдж 7886 0 объект > эндобдж 8013 0 объект > эндобдж 7968 0 объект > эндобдж 8015 0 объект > эндобдж 8018 0 объект > поток hL = 0 ~ ōɐ 륤 _ «z8C-TĿo ([^ Hx.ГГОд «Ѣ`9L.P &` @ LXo82uAxEѬY5,; r bD \ 8Ie6uᵩ) l_apuN #

    Страница не найдена | Андра международный

    Проектов

    Для тех отходов, которые в настоящее время не имеют конечной точки захоронения, таких как высокоактивные или низкоактивные и долгоживущие отходы, Andra проводит исследования, разработки и диалог с заинтересованными сторонами для разработки и внедрения безопасных и приемлемых решений.

    Учить больше .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *