Кратность автоматических выключателей: назначение, как выбрать, характеристики, типы

Содержание

A, B, C и D

Автоматическими выключателями называются приборы, отвечающие за защиту электроцепи от повреждений, связанных с воздействием на нее тока большой величины. Слишком сильный поток электронов способен вывести из строя бытовую технику, а также вызвать перегрев кабеля с последующим оплавлением и возгоранием изоляции. Если вовремя не обесточить линию, это может привести к пожару, Поэтому, в соответствии с требованиями ПУЭ (Правила устройства электроустановок), эксплуатация сети, в которой не установлены электрические автоматы защиты, запрещена. АВ обладают несколькими параметрами, один из которых – время токовая характеристика автоматического защитного выключателя. В этой статье мы расскажем, чем различаются автоматические выключатели категории A, B, C, D и для защиты каких сетей они используются.

Особенности работы автоматов защиты сети

К какому бы классу ни относился автоматический выключатель, его главная задача всегда одна – быстро определить появление чрезмерного тока, и обесточить сеть раньше, чем будет поврежден кабель и подключенные к линии устройства.

Токи, которые могут представлять опасность для сети, подразделяются на два вида:

  • Токи перегрузки. Их появление чаще всего происходит из-за включения в сеть приборов, суммарная мощность которых превышает ту, что линия способна выдержать. Другая причина перегрузки – неисправность одного или нескольких устройств.
  • Сверхтоки, вызванные КЗ. Короткое замыкание происходит при соединении между собой фазного и нейтрального проводников. В нормальном состоянии они подключены к нагрузке по отдельности.

Устройство и принцип работы автоматического выключателя – на видео:

Токи перегрузки

Величина их чаще всего незначительно превышает номинал автомата, поэтому прохождение такого электротока по цепи, если оно не затянулось слишком надолго, не вызывает повреждения линии. В связи с этим мгновенного обесточивания в таком случае не требуется, к тому же нередко величина потока электронов быстро приходит в норму. Каждый АВ рассчитан на определенное превышение силы электротока, при котором он срабатывает.

Время срабатывания защитного автоматического выключателя зависит от величины перегрузки: при небольшом превышении нормы оно может занять час и более, а при значительном – несколько секунд.

За отключение питания под воздействием мощной нагрузки отвечает тепловой расцепитель, основой которого является биметаллическая пластина.

Этот элемент нагревается под воздействием мощного тока, становится пластичным, изгибается и вызывает срабатывание автомата.

Токи короткого замыкания

Поток электронов, вызванный КЗ, значительно превосходит номинал устройства защиты, в результате чего последнее немедленно срабатывает, отключая питание. За обнаружение КЗ и немедленную реакцию аппарата отвечает электромагнитный расцепитель, представляющий собой соленоид с сердечником. Последний под воздействием сверхтока мгновенно воздействует на отключатель, вызывая его срабатывание. Этот процесс занимает доли секунды.

Однако существует один нюанс. Иногда ток перегрузки может также быть очень большим, но при этом не вызванным КЗ. Как же аппарат должен определить различие между ними?

На видео про селективность автоматических выключателей:

Здесь мы плавно переходим к основному вопросу, которому посвящен наш материал. Существует, как мы уже говорили, несколько классов АВ, различающихся по времятоковой характеристике. Наиболее распространенными из них, которые применяются в бытовых электросетях, являются устройства классов B, C и D. Автоматические выключатели, относящиеся к категории A, встречаются значительно реже. Они наиболее чувствительны и используются для защиты высокоточных аппаратов.

Между собой эти устройства различаются по току мгновенного расцепления. Его величина определяется кратностью тока, проходящего по цепи, к номиналу автомата.

Характеристики срабатывания защитных автоматических выключателей

Класс АВ, определяющийся этим параметром, обозначается латинским литером и проставляется на корпусной части автомата перед цифрой, соответствующей номинальному току.

В соответствии с классификацией, установленной ПУЭ, защитные автоматы подразделяются на несколько категорий.

Автоматы типа МА

Отличительная черта таких устройств – отсутствие в них теплового расцепителя. Аппараты этого класса устанавливают в цепях подключения электрических моторов и других мощных агрегатов.

Защиту от перегрузок в таких линиях обеспечивает реле максимального тока, автоматический выключатель только предохраняет сеть от повреждений в результате воздействия сверхтоков короткого замыкания.

Приборы класса А

Автоматы типа А, как было сказано, обладают самой высокой чувствительностью. Тепловой расцепитель в устройствах с времятоковой характеристикой А чаще всего срабатывает при превышении силой тока номинала АВ на 30%.

Катушка электромагнитного расцепления обесточивает сеть в течение примерно 0,05 сек, если электроток в цепи превышает номинальный на 100%. Если по какой-либо причине после увеличения силы потока электронов в два раза электромагнитный соленоид не сработал, биметаллический расцепитель отключает питание в течение 20 – 30 сек.

Автоматы, имеющие времятоковую характеристику А, включаются в линии, при работе которых недопустимы даже кратковременные перегрузки. К таковым относятся цепи с включенными в них полупроводниковыми элементами.

Защитные устройства класса B

Аппараты категории B обладают меньшей чувствительностью, чем относящиеся к типу A. Электромагнитный расцепитель в них срабатывает при превышении номинального тока на 200%, а время на срабатывание составляет 0,015 сек. Срабатывание биметаллической пластины в размыкателе с характеристикой B при аналогичном превышении номинала АВ занимает 4-5 сек.

Оборудование этого типа предназначено для установки в линиях, в которые включены розетки, приборы освещения и в других цепях, где пусковое повышение электротока отсутствует либо имеет минимальное значение.

Автоматы категории C

Устройства типа C наиболее распространены в бытовых сетях. Их перегрузочная способность еще выше, чем у ранее описанных. Для того, чтобы произошло срабатывание соленоида электромагнитного расцепления, установленного в таком приборе, нужно, чтобы проходящий через него поток электронов превысил номинальную величину в 5 раз. Срабатывание теплового расцепителя при пятикратном превышении номинала аппарата защиты происходит через 1,5 сек.

Установка автоматических выключателей с времятоковой характеристикой C, как мы и говорили, обычно производится в бытовых сетях. Они отлично справляются с ролью вводных устройств для защиты общей сети, в то время как для отдельных веток, к которым подключены группы розеток и осветительные приборы, хорошо подходят аппараты категории B.

Это позволит соблюсти селективность защитных автоматов (избирательность), и при КЗ в одной из веток не будет происходить обесточивания всего дома.

Автоматические выключатели категории Д

Эти устройства имеют наиболее высокую перегрузочную способность. Для срабатывания электромагнитной катушки, установленной в аппарате такого типа, нужно, чтобы номинал по электротоку защитного автомата был превышен как минимум в 10 раз.

Срабатывание теплового расцепителя в этом случае происходит через 0,4 сек.

Устройства с характеристикой D наиболее часто используются в общих сетях зданий и сооружений, где они играют подстраховочную роль. Их срабатывание происходит в том случае, если не произошло своевременного отключения электроэнергии автоматами защиты цепи в отдельных помещениях. Также их устанавливают в цепях с большой величиной пусковых токов, к которым подключены, например, электромоторы.

Защитные устройства категории K и Z

Автоматы этих типов распространены гораздо меньше, чем те, о которых было рассказано выше. Приборы типа K имеют большой разброс в величинах тока, необходимых для электромагнитного расцепления. Так, для цепи переменного тока этот показатель должен превышать номинальный в 12 раз, а для постоянного – в 18. Срабатывание электромагнитного соленоида происходит не более чем через 0,02 сек. Срабатывание теплового расцепителя в таком оборудовании может произойти при превышении величины номинального тока всего на 5%.

Этими особенностями обусловлено применение устройств типа K в цепях с исключительно индуктивной нагрузкой.

Приборы типа Z тоже имеют разные токи срабатывания соленоида электромагнитного расцепления, но разброс при этом не столь велик, как в АВ категории K. В цепях переменного тока для их отключения превышение токового номинала должно быть трехкратным, а в сетях постоянного – величина электротока должна быть в 4,5 раза больше номинальной.

Аппараты с характеристикой Z используются только в линиях, к которым подключены электронные устройства.

Наглядно про категории автоматов на видео:

Заключение

В этой статье мы рассмотрели время токовые характеристики защитных автоматов, классификацию этих устройств в соответствии с ПУЭ, а также разобрались, в каких цепях устанавливаются приборы различных категорий. Полученная информация поможет вам определить, какое защитное оборудование следует использовать в сети, исходя из того, какие устройства к ней подключены.

A, B, C, D, K и Z

На сегодняшний день автоматические выключатели стали незаменимым частью электрической цепи как на производстве, так и в быту. Все автоматические выключатели обладают множеством параметров, один из которых – время токовая характеристика. В данной статьи мы рассмотрим, чем отличаются автоматы с время токовой характеристиками категории A, B, C, D и где данные выключатели применяются.


Работа автоматического выключателя

Независимо от того к какому классу относится автоматический выключатель, его основная задача — это срабатывание в случае появления чрезмерного тока в сети, и прежде, чем произойдет повреждение защитного оборудования и кабеля автомат должен обесточить сеть.

 В сети бывают 2 вида опасных для сети токов:

Сверхтоки вызванный КЗ. Причиной возникновения короткого замыкания является замыкание нейтрального и фазного проводника между собой. В обычном состоянии фазный и нейтральный провод подключены к нагрузке отдельно друг от друга.

Токи перегрузки. Появление таких токов зачастую происходит в том случае, если суммарная мощность подключенных устройств к линии превышает предельно допустимую норму.

 Токи перегрузки

Токи перегрузки зачастую бывают немного больше номинального значения тока автомата, поэтому токи перегрузки как правило не вызывают повреждение цепи в случае недолговременной продолжительности действия. Следовательно, нам не нужно мгновенно отключать сеть в данном случае (зачастую величина тока быстро приходит в норму). В каждом автоматическом выключателе предусмотрено определенное превышение силы тока, которое приводит к срабатыванию автомата.

Время срабатывания автоматического выключателя связано с величиной перегрузки. При значительном превышении номинала выключение автомата происходит за считанные секунды, а при небольшом превышении нормы, срабатывание автомата может произойти в течении часа и больше. Данная особенность обусловлена использованием в автомате биметаллической пластины, которая изгибается при нагреве током превышающего норму и тем самым приводит к срабатыванию автомата. Чем большее значение тока, тем быстрее изгибается пластина и тем раньше срабатывает автомат.

Токи КЗ

При правильном выборе автомата, ток КЗ должен приводить к его мгновенному срабатыванию. За обнаружение и немедленную реакцию автомата отвечает электромагнитный расцепитель. Конструктивно расцепитель представляет собой соленоид с сердечником. Под воздействием сверхтока сердечник вызывает мгновенное срабатывание автомата и данное отключение должно происходить в течении доли секунд.

Здесь мы плавно переходим к основному вопросу, которому посвящен наш материал. Существует, как мы уже говорили, несколько классов АВ, различающихся по времятоковой характеристике. Наиболее распространенными из них, которые применяются в бытовых электросетях, являются устройства классов B, C и D. Автоматические выключатели, относящиеся к категории A, встречаются значительно реже. Они наиболее чувствительны и используются для защиты высокоточных аппаратов.

Теперь мы плавно переходим к главному вопросу связанному с срабатыванием автоматических выключателей в зависимости от его времятоковой характеристики. Между собой эти устройства различаются по току мгновенного расцепления. Его величина определяется кратностью тока, проходящего по цепи, к номиналу автомата.

 Автоматы типа МА

Главная особенность подобных устройств – отсутствие в них теплового расцепителя. Обычно подобные устройства ставят для защиты электрических моторов и прочих мощных устройств.

Устройства класса А

Автоматы класса А имеют самый высокий порог чувствительности. В устройствах с времятоковой характеристикой А, тепловой расцепитель, как правило срабатывает в случае превышении воздействующей силы тока на 30% больше номинала выключателя.

Стоит учесть, что подобные автоматы устанавливаются в линии, в которой не допустимы даже кратковременные перегрузки. К примеру, это может быть цепь с полупроводниковыми элементами.

Защитные устройства класса B

Все устройства категории В имеют меньшую чувствительность, в сравнении с устройствами категории А. Срабатывание электромагнитного расцепителя в них происходит при превышении номинала автомата на 200%. При этом время срабатывания данных устройств составляет 0,015 сек.

Устройства категории В используются для установки в линиях, в которые включены приборы освещения, розетки и также в других цепях, в которых отсутствует пусковые токи или они имеют минимальное значение.

Устройства категории С

Устройства типа С весьма распространены в бытовых сетях. Устойчивость к перегрузкам у данных устройств выше, нежели у всех вышеперечисленных. Чтобы произошло срабатывание соленоида электромагнитного расцепителя, требуется превышение проходящего через расцепитель тока в 5 раз выше номинального значения. Тепловой расцепитель срабатывает в случае превышения номинала в 5 раз через 1,5 сек.

Как упоминалось ранее выключатели с времятоковой характеристикой С обычно устанавливаются в бытовых сетях. Данные устройства отлично работают в роли вводных устройств для защиты общей сети.

Вы можете купить автоматические выключатели категории С от лучших производителей:

Автоматы CHINT

Автоматы IEK

Автоматические выключатели категории D

Выключатели категории D имеют наиболее высокую перегрузочную способность. Электромагнитная катушка в устройстве срабатывает при превышении номинала автомата, как минимум в 10 раз.

Тепловой расцепитель срабатывает через 0,4 сек.

Зачастую устройства категории D применяются в общих сетях зданий и сооружений в роли страховки. Данные устройства срабатывают в том случае, если не произошло своевременное срабатывание автоматов защиты цепи в отдельных помещениях. Также автоматы категории D могут устанавливаться в цепях с большими пусковыми токами.

Вы можете купить автоматические выключатели категории D здесь:

Автоматы CHINT

Автоматы IEK

 Защитные устройства категории K и Z

Автоматы категории K и Z встречаются довольно редко. Устройства категории К имеют большой разброс в значениях тока, требуемых для электромагнитного расцепителя. К примеру, для цепи переменного тока данный показатель должен превышать номинал в 12 раз, а в случае применения в цепи постоянного тока, в 18 раз. Электромагнитный соленоид срабатывает через 0,02 сек. Тепловой расцепитель может сработать при превышении номинала всего на 5%.

Из-за своих свойств устройства категории К применяются в цепях с исключительно индуктивной нагрузкой.

Устройства категории Z также имеют различные токи срабатывания соленоида электромагнитного расцепителя, но разброс для данного варианта, не настолько большой, как в выключателях с категорией К. В цепи постоянного тока величина тока должна быть в 4,5 раза выше номинала, а в сетях переменного тока для срабатывания автомата, ток должен превысить автомат в 3 раза. Устройства категории Z обычно используют для защиты электроники.

Кривая срабатывания автоматических выключателей

Кривые срабатывания автоматических выключателей, они же время-токовые характеристики, показывают зависимость времени отключения автоматического выключателя от величины тока.

Конструкция автоматических выключателей

Автоматический выключатель состоит из двух расцепителей — теплового расцепителя и электромагнитного.

Тепловой расцепитель — это биметаллическая пластина. При протекании тока пластина нагревается и меняет свою форму (изгибается). Таким образом, при протекании тока, который превышает номинальный ток автомата, биметаллическая пластина изгибается настолько сильно, что происходит отключение автомата. Когда вы включаете автомат — взводится пружина и она фиксируется рычажком, который фиксирует автомат во включенном положении. Этот самый рычажок биметаллическая пластина и снимает.

Электромагнитный расцепитель предназначен для защиты от короткого замыкания. При коротком замыкании в кабеле протекает ток, который в несколько раз превышает номинальный ток автомата. Этот ток необходимо мгновенно отключить. Для это в механизме автомата используется электромагнит — катушка и сердечник. При протекании тока катушка втягивает сердечник, который нажимает на фиксирующий рычажок и, таким образом, приводит в действие механизм отключения.

Типы кривых срабатывания

Параметры автоматических выключателей и их кривых срабатывания (время-токовых характеристик) жестко определены межгосударственным стандартом ГОСТ IEC 60898.

Рассмотрим эти кривые подробнее. Их построение выполняют по логорифмической шкале. По горизонтали (оси абсцисс) откладывают кратность значения номинального тока (отношения тока к номинальному току автоматического выключателя). По вертикали (оси ординат) откладывают время в секундах и минутах. Время-токовые характеристики можно разделить на две части: верхняя ниспадающая часть и нижняя вертикальная.

Верхняя часть кривой показывает процесс работы теплового расцепителя. Чем меньше превышение тока тока над номинальным током автомата, тем медленнее изгибается биметаллическая пластина и тем дольше она отключает автомат.

Нижняя часть показывает процесс работы электромагнитного расцепителя.  Эта часть кривой срабатывания имеет закругление вблизи нуля — это время движения механических контактов при размыкании. Мгновенно это произойти не может, но время очень мало.

Стандартом предусмотрены три типа автоматов с различными характиристиками срабатывания, которые определяются по диапазону срабатывания электромагнитного расцепителя:

  • Характеристика B — 3-5•Iном;
  • Характеристика C — 5-10•Iном;
  • Характеристика D — 10-20•Iном.

Таким образом, для различных типов нагрузок выбирают автомат с соответствующей характеристикой. Для нагрузок с низкими пусковыми токами — с характеристикой «B». Для нагрузок с большими пусковыми токами (например, двигателей) — с характеристикой «D».

Причем, в новой редакции стандарта — ГОСТ IEC 60898-2-2011 характеристика «D» отсутствует.

Испытания автоматических выключателей

Стандартом предусмотрены следующие испытания:

  1. Начальное состояние автомата — «холодное», т.е. через него перед этим не пропускался ток. Через автомат пропускают ток 1.13•Iном.
  2. Начальное состояние автомата — сразу после испытания «a». Через автомат пропускают ток 1.45•Iном.
  3. Начальное состояние автомата — «холодное». Через автомат пропускают ток 2.55•Iном.
  4. Начальное состояние автомата — «холодное». Через автомат пропускают ток нижней границы диапазона характеристики (3•Iном для «B», 5•Iном для «C»).
  5. Начальное состояние автомата — «холодное». Через автомат пропускают ток верхней границы диапазона характеристики (5•Iном для «B», 10•Iном для «C»).

Результатом испытания «a» является отсутствие срабатывания автомата за время t>1час для автоматов с номинальным током Iном≤63A и t>2час для автоматов с Iном>63A.

Результатом испытания «b» является срабатывание автомата за время t<1час для автоматов с номинальным током Iном≤63A и t<2час для автоматов с Iном>63A.

Результатом испытания «c» является срабатывание автомата в пределах 1с<t<60c для автомата с Iном≤32A и 1с<t<120c для автомата с Iном>32A.

Результатом испытания «d» является срабатывание автомата с характеристикой «B» в пределах 0,1с<t<45c для автомата с Iном≤32A и 0,1с<t<90c для автомата с Iном>32A; с характеристикой «C» в пределах 0,1с < t < 15c для автомата с Iном≤32A и 0,1с<t< 30c для автомата с Iном>32A.

Результатом испытания «e» является срабатывание автомата за время t<0,1c.

По этим точкам строят время-токовые характеристики, а сами точки выделены на кривых.

Важные выводы

  1. Получается, что если ток нагрузки, который протекает через автомат, превышает номинальный ток автомата меньше, чем в 1.13 раз, то автомат не отключится. Это обстоятельство следует учитывать при выборе кабеля.
  2. При проектировании следует учитывать, что требования п.1.7.79 ПУЭ гарантированно выполняются только в том случае, если ток короткого замыкания превышает верхнюю границу диапазона срабатывания, т.е. 5•Iном для характеристики «B», 10•Iном для характеристики «C», 20•Iном для характеристики «D». Эти величины кратности срабатывания следует использовать при проверке времени срабатывания автоматического выключателя при однофазном коротком замыкании.

Подпишитесь и получайте уведомления о новых статьях на e-mail

Читайте также:

Описание параметра «Характеристика срабатывания электромагнитного расцепителя»

Тип мгновенного расцепления модульных автоматических выключателей указывается одной или двумя латинскими буквами.  Данные символы определяют кратность номинального тока, при которой сработает электромагнитный расцепитель.

Согласно ГОСТ Р 50345-2010 существуют следующие значения:

  • В (3-5In) — защита электронной аппаратуры, систем освещения с лампами накаливания, ТЭНов;
  • С (5-10In) — защита распределительных сетей, систем освещения с газоразрядными лампами, бытовой техники;
  • D (10-20In) — защита трансформаторов и электродвигателей.

Также существуют типы мгновенного расцепления не предусмотренные стандартом — их устанавливают сами производители автоматических выключателей.

  • А (2-3In) — защита от сверхтока электрических цепей с полупроводниковыми приборами, измерительных цепей с преобразователями, а также электропроводок большой протяженности при необходимости их отключения за время не более 0,2с — являются разработкой фирмы SIEMENS.
  • Z (3,2-4,8In) — защита полупроводников и измерительных цепей трансформаторов
  • L (6,4-9,6In) — защита распределительных сетей
  • K (9,6-14,4In) — защита электродвигателей

В случае наличия обозначения MA следует, что данный автоматический выключатель не имеет теплового расцепителя. И следовательно невозможно задать кратность относительно номинального тока. В таких случаях у автоматических выключателей указывается непосредственно значение тока короткого замыкания при превышении, которого сработает электромагнитный расцепитель

B (3-5In) C (5-10In) D (10-20In)

A (2-3In) – разработка SIEMENS

характеристики срабатывания автоматов

Чувствительность электромагнитных расцепителей регламентируется параметром, называемым характеристикой срабатывания. Это важный параметр, и на нем стоит немного задержаться. Характеристика, иногда ее называют группой, обозначается одной латинской буквой, на корпусе автомата ее пишут прямо перед его номиналом, например надпись C16 означает, что номинальный ток автомата 16А, характеристика С (наиболее, кстати, распространенная). Менее популярны автоматы с характеристиками B и D, в основном на этих трех группах и строится токовая защита бытовых сетей. Но есть автоматы и с другими характеристиками.

Согласно википедии, автоматические выключатели делятся на следующие типы (классы) по току мгновенного расцепления:

  • тип B: свыше 3·In до 5·In включительно (где In — номинальный ток)
  • тип C: свыше 5·In до 10·In включительно
  • тип D: свыше 10·In до 20·In включительно
  • тип L: свыше 8·In
  • тип Z: свыше 4·In
  • тип K: свыше 12·In

При этом википедия ссылается на ГОСТ Р 50345-2010. Я специально перечитал весь этот стандарт, но ни о каких типах L, Z, K в нем ни разу не упоминается. В другом месте ссылались на уже не действующий ГОСТ Р 50030.2-94 — но я и в нем упоминания о них не нашел. Да и в продаже я что-то не наблюдаю таких автоматов. У европейских производителей классификация может несколько отличаться. В частности, имеется дополнительный тип A (свыше 2·In до 3·In). У отдельных производителей существуют дополнительные кривые отключения. Например, у АВВ имеются автоматические выключатели с кривыми K (8 — 14·In) и Z (2 — 4·In), соответствующие стандарту МЭК 60947-2. В общем, будем иметь в виду, что, кроме B, C и D существуют и иные кривые, но в данной статье будем рассматривать только эти. Сами по себе кривые отключения одинаковы — они вообще показывают зависимость времени срабатывания теплового расцепителя от тока. Разница лишь в том, до какой отметки доходит кривая, после чего она резко обрывается до значения, близкого к нулю. Посмотрите на следующую картинку, обратите внимание на разброс параметров тепловой защиты автоматических выключателей. Видите два числа сверху графика? Это очень важные числа. 1.13 — это та кратность, ниже которой никакой исправный автомат никогда не сработает. 1.45 — это та кратность, при которой любой исправный автомат гарантированно сработает. Что они означают на деле? Рассмотрим на примере. Возьмем автомат на 10А. Если мы пропустим через него ток 11.3А или меньше, он не отключится никогда. Если мы увеличим ток до 12, 13 или 14 А — наш автомат может через какое-то время отключиться, а может и не отключиться вовсе. И только когда ток превысит значение 14.5А, мы можем гарантировать, что автомат отключится. Насколько быстро — зависит от конкретного экземпляра. Например, при токе 15А время срабатывания может составлять от 40 секунд до 5 минут. Поэтому, когда кто-то жалуется, что у него 16-амперный автомат не срабатывает на 20 амперах, он это делает напрасно — автомат совершенно не обязан срабатывать при такой кратности. Более того — эти графики и цифры нормированы для температуры окружающей среды, равной 30°C, при более низкой температуре график смещается вправо, при более высокой — влево.

Для характеристик k, l, z кривые несколько другие: кратность гарантированного несрабатывания 1.05, а срабатывания 1.3. Извините, более красивого графика не нашел:

Что нам следует иметь в виду, выбирая характеристику отключения? Здесь на первый план выходят пусковые токи того оборудования, которое мы собираемся включать через данный автомат. Нам важно, чтобы пусковой ток в сумме с другими токами в этой цепи не оказался выше тока срабатывания электромагнитного расцепителя (тока отсечки). Проще тогда, когда мы точно знаем, что будет подключаться к нашему автомату, но когда автомат защищает группу розеток, тогда мы только можем предполагать, что и когда туда будет включено. Конечно, мы можем взять с запасом — поставить автоматы группы D. Но далеко не факт, что ток короткого замыкания в нашей цепи где-нибудь на дальней розетке будет достаточен для срабатывания отсечки. Конечно, через десяток секунд тепловой расцепитель нагреется и отключит цепь, но для проводки это окажется серьезным испытанием, да и возгорание в месте замыкания может произойти. Поэтому нужно искать компромисс. Как показала практика, для защиты розеток в жилых помещениях, офисах — там, где не предполагается использование мощного электроинструмента, промышленного оборудования, — лучше всего устанавливать автоматы группы B. Для кухни и хозблока, для гаражей и мастерских обычно ставятся автоматы с характеристикой C — там, где есть достаточно мощные трансформаторы, электродвигатели, там есть и пусковые токи. Автоматы группы D следует ставить там, где есть оборудование с тяжелыми условиями пуска — транспортеры, лифты, подъемники, станки и т.д.

Существует разница в токе срабатывания электромагнитного расцепителя (отсечки) в зависимости от того, переменный или постоянный ток проходит через автомат. Если мы знаем значение переменного тока, при котором срабатывает отсечка, то при постоянном токе срабатывание произойдет при значении, равном амплитудному значению переменного тока. То есть ток нужно умножить примерно на 1.4. Часто приводят вот такие графики (по-моему, не очень верные, но подтверждающие то, что разница между пременным и постоянным током есть):

Все написанное выше относится к обычным модульным автоматическим выключателям. У автоматов других типов характеристики несколько другие. Например, кривые срабатывания для автоматов АП-50 — в частности, можно заметить одно существенное отличие: кратности токов гарантийного срабатывания и несрабатывания у них другие.

Характеристики срабатывания селективных автоматов

Другие кратности и у селективных автоматов (специальные автоматы, применяемые в качестве групповых). Главное отличие селективных автоматов — их срабатывание происходит с небольшой задержкой, для того, чтобы не отключать всю группу, если авария произошла на одной из линий, защищенной нижестоящим автоматом. Ниже приведены характеристики E и K для селективных автоматических выключателей серии S750DR фирмы ABB:

Усенко К.А., инженер-электрик,

[email protected]

Время-токовые характеристики (ВТХ) автоматических выключателей

Здравствуйте, уважаемые читатели и гости сайта «Заметки электрика».

Вы наверное замечали, что на корпусах модульных автоматов изображены латинские буквы: B, C или D. Так вот они обозначают время-токовую характеристику этого автомата, или другими словами, ток мгновенного расцепления.

Согласно ГОСТа Р 50345-99, п.3.5.17 — это наименьшая величина тока, при котором автоматический выключатель сработает (отключится) без выдержки времени, т.е. это его электромагнитная защита.

В этом же ГОСТе Р 50345-99, п.5.3.5, говорится, что всего существует три стандартные характеристики (типы мгновенного расцепления):

  • B — электромагнитный расцепитель (ЭР) срабатывает в пределах от 3 до 5-кратного тока от номинального (3·In до 5·In)
  • C — (ЭР) срабатывает в пределах от 5 до 10-кратного тока от номинального (5·In до 10·In)
  • D — (ЭР) срабатывает в пределах от 10 до 20-кратного тока от номинального (10·In до 20·In, но встречаются иногда и 10·In до 50·In)

In – номинальный ток автоматического выключателя.

Помимо характеристик типа В, С и D, существуют и не стандартные характеристики типа А, К и Z, но о них я расскажу Вам в следующий раз. Чтобы не пропустить выход новых статей, подписывайтесь на рассылку сайта.

Рассмотрим каждый вид характеристики более подробно на примере модульных автоматических выключателей ВМ63-1 серии OptiDin и Optima от производителя КЭАЗ (Курский Электроаппаратный завод).

 

Время-токовая характеристика типа В

Рассмотрим время-токовую характеристику В на примере автоматических выключателей ВМ63-1 от КЭАЗ. Один автомат с номинальным током 10 (А), а другой — 16 (А).

Обратите внимание, что оба автомата имеют характеристику В, что отчетливо видно по маркировке на их корпусе: В10 и В16.

Для наглядности с помощью, уже известного Вам, испытательного прибора РЕТОМ-21 проверим заявленные характеристики данных автоматов.

Но сначала несколько слов о графике.

Вот график время-токовой характеристики (сокращенно, ВТХ) типа В:

На нем показана зависимость времени отключения автоматического выключателя от протекающего через него тока. Ось Х — это кратность тока в цепи к номинальному току автомата (I/In). Ось У — время срабатывания, в секундах.

Запомните!!! Время-токовые характеристики практически всех автоматов изображаются при температуре +30°С. 

График разделен двумя линиями, которые и определяют разброс времени срабатывания зон теплового и электромагнитного расцепителей автомата. Верхняя линия — это холодное состояние, т.е. без предварительного пропускания тока через автомат, а нижняя линия — это горячее состояние автомата, который только что был в работе или сразу же после его срабатывания.

Пунктирная линия на графике — это верхняя граница (предел) для автоматов с номинальным током менее 32 (А).

1. Токи условного нерасцепления (1,13·In)

У каждого автомата есть такое понятие, как «условный ток нерасцепления» и он всегда равен 1,13·In. При таком токе автомат не отключится в течение 1 часа (для автоматов с номинальным током менее 63А) и в течение 2 часов (для автоматов с номинальным током более 63А).

Точку условного нерасцепления автомата (1,13·In) всегда отображают на графике. Если провести прямую, то видно, что прямая уходит как бы в бесконечность и с нижней линией графика пересекается в точке 60-120 минут.

Например, автомат с номинальным током 10 (А). При протекании через него тока 1,13·In = 11,3 (А) его тепловой расцепитель не сработает в течение 1 часа.

Еще пример, автомат с номинальным током 16 (А). При протекании через него тока 1,13·In = 18,08 (А) его тепловой расцепитель не сработает в течение 1 часа.

Вот значения «токов условного нерасцепления» для различных номиналов:

  • 10 (А) — 11,3 (А)
  • 16 (А) — 18,08 (А)
  • 20 (А) — 22,6 (А)
  • 25 (А) — 28,25 (А)
  • 32 (А) — 36,16 (А)
  • 40 (А) — 45,2 (А)
  • 50 (А) — 56,5 (А)

2. Токи условного расцепления (1,45·In)

Есть еще понятие, как «условный ток расцепления» автомата и он всегда равен 1,45·In. При таком токе автомат отключится за время не более 1 часа (для автоматов с номинальным током менее 63А) и за время не более 2 часов (для автоматов с номинальным током более 63А).

Кстати, точку условного расцепления автомата (1,45·In) практически всегда отображают на графике. Если провести прямую, то видно, что прямая пересекает график в двух точках: нижнюю линию в точке 40 секунд, а верхнюю — в точке 60-120 минут (в зависимости от номинала автомата).

Таким образом, автомат с номинальным током 10 (А) в течение часа, не отключаясь, может держать нагрузку порядка 14,5 (А), а автомат с номинальным током 16 (А) — порядка 23,2 (А). Но это при условии, что автоматы изначально были в холодном состоянии, в ином случае время их отключения будет находиться в пределах от 40 секунд до одного часа.

Вот значения «токов условного расцепления» для различных номиналов:

  • 10 (А) — 14,5 (А)
  • 16 (А) — 23,2 (А)
  • 20 (А) — 29 (А)
  • 25 (А) — 36,25 (А)
  • 32 (А) — 46,4 (А)
  • 40 (А) — 58(А)
  • 50 (А) — 72,5 (А)

Вот об этом не стоит забывать при выборе сечения проводов и кабелей для электропроводки (вот Вам таблица в помощь).

Вот представьте себе, что кабель сечением 2,5 кв.мм Вы защищаете автоматом на 20 (А). Вдруг по некоторым причинам Вы перегрузили линию до 29 (А). Автомат 20 (А) может не отключаться в течение целого часа, а по кабелю будет идти ток, который в значительной мере превышает его длительно-допустимый ток (25 А). За это время кабель сильно нагреется и расплавится, что может привести к пожару или короткому замыканию. А если еще учесть то, что в последнее время производители кабельной продукции преднамеренно занижают сечения жил, то ситуация тем более усугубляется.

В принципе, выбор номиналов автоматических выключателей это отдельная тема для статьи. Я лишь привел здесь одну из наиболее распространенных ошибок. Если интересно, то почитайте мою статью, где я подробно разбирал ошибки одного горе-электрика и переделывал за ним его «творчество».

Лично я рекомендую защищать кабели следующим образом:

  • 1,5 кв.мм — защищаем автоматом на 10 (А)
  • 2,5 кв.мм —  защищаем автоматом на 16 (А)
  • 4 кв.мм —  защищаем автоматом на 20 (А) и 25 (А)
  • 6 кв.мм —  защищаем автоматом на 25 (А) и 32 (А)
  • 10 кв.мм — защищаем автоматом 40 (А)
  • 16 кв.мм — защищаем автоматом 50 (А)

Для удобства все данные я свел в одну таблицу:

Проверить рассмотренные автоматы на токи условного нерасцепления и условного расцепления у меня нет времени, поэтому перейдем к их дальнейшей проверке — это форсированный режим проверки при токе, равном 2,55·In.

3. Проверка теплового расцепителя при токе 2,55·In

Согласно ГОСТа Р 50345-99, п.9.10.1.2 и таблицы №6, если через автоматический выключатель будет проходить ток, равный 2,55·In, то он должен отключиться за время не менее 1 секунды из горячего состояния и не более 60 секунд из холодного состояния (для автоматов с номинальным током менее 32А) и не более 120 секунд из холодного состояния (для автоматов с номинальным током более 32А).

На графике ниже Вы можете видеть, что нижний предел по отключению взят с небольшим запасом, т.е. не 1 секунду, а 4 секунды. На то есть право у производителей автоматов. Вот поэтому они всегда к каждому автомату прикладывают свою ВТХ, которая, естественно, что удовлетворяет всем требованиям ГОСТа Р 50345-99.

Проверим!

Автомат ВМ63-1 от КЭАЗ с номинальным током 10 (А) при токе 25,5 (А) должен отключиться за время не менее 1 секунды из горячего состояния и не более 60 секунд из холодного состояния.

Первый раз автомат отключился за время 14,41 (сек.), а второй раз — 11,91 (сек.).

Автомат ВМ63-1 от КЭАЗ с номинальным током 16 (А) при токе 40,8 (А) должен отключиться за время не менее 1 секунды из горячего состояния и не более 60 секунд из холодного состояния.

Первый раз автомат отключился за время 13,51 (сек.), а второй раз — 7,89 (сек.).

Дополнительно можно проверить тепловой расцепитель, например, при двухкратном токе от номинального, но в рамках данной статьи я этого делать не буду. На сайте имеется уже достаточно статей про прогрузку различных автоматических выключателей, как бытового, так и промышленного исполнения. Вот знакомьтесь:

4. Проверка электромагнитного расцепителя при токе 3·In

Согласно ГОСТа Р 50345-99, п.9.10.2.1 и таблицы №6, если через автоматический выключатель будет проходить ток, равный 3·In, то он должен отключиться за время не менее 0,1 секунды. Верхний предел по времени ГОСТом Р 50345-99 не определен, и у автоматов разных производителей здесь может наблюдаться не большой разброс в пределах от 1 до 10 секунд.

Странно, конечно, ведь речь идет об электромагнитном расцепителе и он должен срабатывать без выдержки времени. Но тем не менее, при токе 3·In электромагнитный расцепитель еще не срабатывает и по факту автомат отключается от теплового расцепителя. Вот именно поэтому измеренное значение петли фаза-ноль

сравнивают с током не 3·In, а с 5·In, учитывая коэффициент 1,1.

Автомат ВМ63-1 от КЭАЗ с номинальным током 10 (А) при токе 30 (А) должен отключиться за время не менее 0,1 секунды.

Первый раз автомат отключился за время 8,71 (сек.), а второй раз — 8,11 (сек.).

Автомат ВМ63-1 от КЭАЗ с номинальным током 16 (А) при токе 48 (А) должен отключиться за время не менее 0,1 секунды.

Первый раз автомат отключился за время 8,16 (сек.), а второй раз — 6,25 (сек.).

5. Проверка электромагнитного расцепителя при токе 5·In

Согласно ГОСТа Р 50345-99, п.9.10.2.1 и таблицы №6, если через автоматический выключатель будет проходить ток, равный 5·In, то он должен отключиться за время менее 0,1 секунды.

Автомат ВМ63-1 от КЭАЗ с номинальным током 10 (А) при токе 50 (А) должен отключиться за время менее 0,1 секунды.

Первый раз автомат отключился за время 7,8 (мсек.), а второй раз — 7,7 (мсек.).

Автомат ВМ63-1 от КЭАЗ с номинальным током 16 (А) при токе 80 (А) должен отключиться за время менее 0,1 секунды.

Первый раз автомат отключился за время 8,5 (мсек.), а второй раз — 8,4 (мсек.).

Как видите, оба автомата полностью соответствуют требованиям ГОСТа Р 50345-99 и заявленным характеристикам завода-изготовителя КЭАЗ.

Кому интересно, как проходила прогрузка автоматов, то смотрите видеоролик:

Автоматы с характеристикой В применяются для защиты распределительных и групповых цепей с большими длинами кабелей и малыми токами короткого замыкания преимущественно с активной нагрузкой, например, электрические печи, электрические нагреватели, цепи освещения.

Но почему-то в магазинах их количество всегда ограничено, т.к. по мнению продавцов наиболее распространенными являются автоматы с характеристикой С. С чего это вдруг?! Вполне логично и целесообразно для групповых линий цепей освещения и розеток применять именно автоматы с характеристикой типа В, а в качестве вводного автомата устанавливать автомат с характеристикой С (это один из вариантов). Так хоть каким-то образом будет соблюдена селективность, и при коротком замыкании где-нибудь в линии вместе с отходящим автоматом не будет отключаться вводной автомат и «гасить» всю квартиру. Но о селективности я еще расскажу Вам более подробно в другой раз.

 

Время-токовая характеристика типа С

Вот ее график:

Автоматы с характеристикой С применяются в основном для защиты трансформаторов и двигателей с малыми пусковыми токами. Также их можно использовать для питания цепей освещения. Нашли они достаточно широкое распространение в жилом фонде, хотя свое мнение об этом я высказал чуть выше.

Внимание! Более подробнее про время-токовую характеристику С читайте в моей отдельной статье.

Время-токовая характеристика типа D

График:

По графику видно следующее:

1. Токи условного нерасцепления (1,13·In) и токи условного расцепления (1,45·In), но о них я расскажу чуть ниже.

2. Если через автоматический выключатель будет проходить ток, равный 2,55·In, то он должен отключиться за время не менее 1 секунды в горячем состоянии и не более 60 секунд в холодном состоянии (для автоматов с номинальным током менее 32А) и не более 120 секунд в холодном состоянии (для автоматов с номинальным током более 32А).

3. Если через автоматический выключатель будет проходить ток, равный 10·In, то он должен отключиться за время не менее 0,1 секунды.

4. Если через автоматический выключатель будет проходить ток, равный 20·In, то он должен отключиться за время менее 0,1 секунды.

Автоматы с характеристикой D применяются в основном для защиты электрических двигателей с частыми запусками или значительными пусковыми токами (тяжелый пуск).

 

Изменение характеристик расцепления автоматов

Как я уже говорил в начале статьи, все характеристики изображаются при температуре окружающего воздуха +30°С. Поэтому, чтобы узнать время отключения автоматов при других температурах, необходимо учитывать следующие поправочные коэффициенты:

1. Температурный коэффициент окружающего воздуха — Кt.

Думаю тут все понятно из графика. Чем ниже температура воздуха, тем значение коэффициента больше, а значит и увеличивается номинальный ток автомата, другими словами, его нагрузочная способность. Или, наоборот, чем жарче, тем нагрузочная способность автомата становится меньше. Ведь не зря, в жарких помещениях или летнюю жару многие замечают частые отключения автоматов, хотя нагрузка вовсе не изменялась. Ответ кроется в этом графике.

2. Коэффициент, учитывающий количество рядом установленных автоматов — Кn.

Здесь тоже никаких премудростей нет. Когда в одном ряду установлено несколько автоматов, то они передают свое тепло рядом стоящим автоматам. Этот график учитывает конвекцию тепла и выдает корректирующий коэффициент, учитывающий этот фактор.

Логика проста. Чем больше в ряду автоматов, тем больше уменьшается их нагрузочная способность.

Далее необходимо найти ток, приведенный к условиям нашего окружающего воздуха и монтажа:

In* = In · Кt · Кn

Как эти два коэффициента применить на практике?

Для этого рассмотрим пример. Щиток стоит на улице, в нем установлены 4 автомата — один вводной (ВА47-29 С40) и три групповых (ВА47-29 С16). Температура окружающего воздуха составляет -10°С.

Найдем поправочные коэффициенты для группового автомата ВА47-29 С16:

Найдем ток, приведенный к нашим условиям:

In* = In · Кt · Кn = 16 · 1,1  · 0,82 = 14,43 (А)

Таким образом, при определении времени срабатывания автомата по характеристике С кратность тока нужно брать не как отношение I/In (I/16), а как I/In* (I/14,43).

 

Заключение

Все вышесказанное в данной статье я представлю в виде общей таблицы (можете смело копировать ее и пользоваться):

Если Вы заметили, то разницей между время-токовыми характеристиками В, С и D являются только значения срабатывания электромагнитного расцепителя. По тепловой защите они работают в одних интервалах времени.

P.S. Надеюсь, что после прочтения данной статьи Вы сможете самостоятельно определять пределы времени срабатывания любых автоматических выключателей, а также правильно рассчитывать сечения проводов под номиналы автоматов.

Если статья была Вам полезна, то поделитесь ей со своими друзьями:


Что такое время токовые характеристики автоматических выключателей

При нормальной работе электросети и всех приборов через автоматический выключатель протекает электрический ток. Однако если сила тока по каким-либо причинам превысила номинальные значения, происходит размыкание цепи из-за срабатывания расцепителей автоматического выключателя.

Характеристика срабатывания автоматического выключателя является очень важной характеристикой, которая описывает то, насколько время срабатывания автомата зависит от отношения силы тока, протекающего через автомат, к номинальному току автомата.

Данная характеристика сложна тем, что для ее выражения необходимо использование графиков. Автоматы с одним и тем же номиналом будут при разных превышениях тока по-разному отключаться в зависимости от типа кривой автомата (так иногда называется токовая характеристика), благодаря чему имеется возможность применять автоматы с разной характеристикой для разных типов нагрузки.

Тем самым, с одной стороны, осуществляется защитная токовая функция, а с другой стороны, обеспечивается минимальное количество ложных срабатываний – в этом и заключается важность данной характеристики.

В энергетических отраслях бывают ситуации, когда кратковременное увеличение тока не связано с появлением аварийного режима и защита не должно реагировать на такие изменения. Это же относится и к автоматам.

При включении какого-нибудь мотора, к примеру, дачного насоса или пылесоса, в линии происходит достаточно большой бросок тока, который в несколько раз превышает нормальный.

По логике работы, автомат, конечно же, должен отключиться. К примеру, мотор потребляет в пусковом режиме 12 А, а в рабочем – 5. Автомат стоит на 10 А, и от 12 его вырубит. Что в таком случае делать? Если например поставить на 16 А, тогда непонятно отключится он или нет если заклинит мотор или замкнет кабель.

Можно было бы решить эту проблему, если его поставить на меньший ток, но тогда он будет срабатывать от любого движения. Вот для этого и было придумано такое понятие для автомата, как его «время токовая характеристика».

Какие существуют время токовые характеристики автоматических выключателей и их отличие между собой

Как известно основными органами срабатывания автоматического выключателя являются тепловой и электромагнитный расцепитель.

Тепловой расцепитель представляет собой пластину из биметалла, изгибающуюся при нагреве протекающим током. Тем самым в действие приводится механизм расцепления, при длительной перегрузке срабатывая, с обратнозависимой выдержкой времени. Нагрев биметаллической пластинки и время срабатывание расцепителя напрямую зависят от уровня перегрузки.

Электромагнитный расцепитель является соленоидом с сердечником, магнитное поле соленоида при определенном токе втягивает сердечник, приводящий в действие механизм расцепления – происходит мгновенное срабатывание при КЗ, благодаря чему пострадавший участок сети не будет дожидаться прогревания теплового расцепителя (биметаллической пластины) в автомате.

Зависимость времени срабатывания автомата от силы тока, протекающего через автомат, как раз и определяется время токовой характеристикой автоматического выключателя.

Наверное, каждый замечал изображение латинских букв B, C, D на корпусах модульных автоматов. Так вот они характеризуют кратность уставки электромагнитного расцепителя к номиналу автомата, обозначая его время токовую характеристику.

Эти буквы указывают ток мгновенного срабатывания электромагнитного расцепителя автомата. Проще говоря, характеристика срабатывания автоматического выключателя показывает чувствительность автомата – наименьший ток при котором автомат отключится мгновенно.

Автоматы имеют несколько характеристик, самыми распространенными из которых являются:

  • — B — от 3 до 5 ×In;
  • — C — от 5 до 10 ×In;
  • — D — от 10 до 20 ×In.

Что означают цифры указанные выше?

Приведу небольшой пример. Допустим, есть два автомата одинаковой мощности (равные по номинальному току) но характеристики срабатывания (латинские буквы на автомате) разные: автоматы В16 и С16.

Диапазоны срабатывания электромагнитного расцепителя для В16 составляет 16*(3…5)=48…80А. Для С16 диапазон токов мгновенного срабатывания 16*(5…10)=80…160А.

При токе 100 А автомат В16 отключится практически мгновенно, в то время как С16 отключится не сразу а через несколько секунд от тепловой защиты (после того как нагреется его биметаллическая пластина).

В жилых зданиях и квартирах, где нагрузки чисто активные (без больших пусковых токов), а какие-нибудь мощные моторы включаются нечасто, самыми чувствительными и предпочтительными к применению являются автоматы с характеристикой B. На сегодняшний день очень распространена характеристика С, которую также можно использовать для жилых и административных зданий.

Что касается характеристики D, то она как раз годится для питания каких-либо электромоторов, больших двигателей и других устройств, где могут быть при их включении большие пусковые токи. Также через пониженную чувствительность при КЗ автоматы с характеристикой D могут быть рекомендованы для использования как вводные для повышения шансов селективности со стоящими ниже групповыми АВ при КЗ.

Согласитесь логично, что время срабатывания зависит от температуры автомата. Автомат отключится быстрее, если его тепловой орган (биметаллическая пластина) разогретый. И наоборот при первом включении когда биметалл автомата холодный время отключения будет больше.

Поэтому на графике верхняя кривая характеризует холодное состояние автомата, нижняя кривая характеризует горячее состояние автомата.

Пунктирной линией обозначен предельный ток срабатывания для автоматов до 32 А.

Что показано на графике время токовой характеристики

На примере 16-Амперного автомата, имеющего время токовую характеристику C, попробуем рассмотреть характеристики срабатывания автоматических выключателей.

На графике можно увидеть, как протекающий через автоматический выключатель ток влияет на зависимость времени его отключения. Кратность тока протекающего в цепи к номинальному току автомата (I/In) изображает ось Х, а время срабатывания, в секундах – ось У.

Выше говорилось, что в состав автомата входит электромагнитный и тепловой расцепитель. Поэтому график можно разделить на два участка. Крутая часть графика показывает защиту от перегрузки (работа теплового расцепителя), а более пологая часть защиту от КЗ (работа электромагнитного расцепителя).

Как видно на графике если к автомату С16 подключить нагрузку 23 А то он должен отключится за 40 сек. То есть при возникновении перегрузки на 45 % автомат отключится через 40 сек.

На токи большой величины, которые могут привести к повреждению изоляции электропроводки автомат способен реагировать мгновенно благодаря наличию электромагнитного расцепителя.

При прохождении через автомат С16 тока 5×In (80 А) он должен сработать через 0.02 сек (это если автомат горячий). В холодном состоянии, при такой нагрузке, он отключится в пределах 11 сек. и 25 сек. (для автоматов до 32 А и выше 32 А соответственно).

Если через автомат будет протекать ток равный 10×In, то он отключается за 0,03 секунды в холодном состоянии или меньше чем за 0,01 секунду в горячем.

К примеру, при коротком замыкании в цепи, которая защищена автоматом С16, и возникновении тока в 320 Ампер, диапазон времени отключения автомата будет составлять от 0,008 до 0,015 секунды. Это позволит снять питание с аварийной цепи и защитить от возгорания и полного разрушения сам автомат, закоротивший электроприбор и электропроводку.

Автоматы с какими характеристиками предпочтительнее использовать дома

В квартирах по возможности необходимо обязательно применять автоматы категории B, которые являются более чувствительными. Данный автомат отработает от перегрузки так же, как и автомат категории С. А вот о случае короткого замыкания?.

Если дом новый, имеет хорошее состояние электросети, подстанция находится рядом, а все соединения качественные, то ток при коротком замыкании может достигать таких величин, что его должно хватить на срабатывание даже вводного автомата.

Ток может оказаться малым при коротком замыкании, если дом является старым, а к нему идут плохие провода с огромным сопротивлением линии (особенно в сельских сетях, где большое сопротивление петли фаза-нуль) – в таком случае автомат категории C может не сработать вообще. Поэтому единственным выходом из этой ситуации является установка автоматов с характеристикой типа В.

Следовательно, время токовая характеристика типа В является определенно более предпочтительной, в особенности в дачной или сельской местности или в старом фонде.

В быту на вводной автомат вполне целесообразно ставить именно тип С, а на автоматы групповых линий для розеток и освещения – тип В. Таким образом будет соблюдена селективность, и где-нибудь в линии при коротком замыкании вводной автомат не будет отключаться и «гасить» всю квартиру.

Похожие материалы на сайте:

Понравилась статья — поделись с друзьями!

 

Деградация автоматических выключателей Westinghouse на 480 В с возрастом (Технический отчет)

Субудхи, М., Шиер, В. и МакДугалл, Э. Возрастной износ автоматических выключателей Westinghouse на 480 В . США: Н. П., 1990. Интернет. DOI: 10,2172 / 7028755.

Субудхи, М., Шиер, В., и Макдугал, Э. Возрастная деградация автоматических выключателей Westinghouse на 480 В . Соединенные Штаты. https://doi.org/10.2172/7028755

Субудхи, М., Шайер, В., и Макдугал, Э. Сан. «Возрастная деградация автоматических выключателей Westinghouse на 480 вольт». Соединенные Штаты. https://doi.org/10.2172/7028755. https://www.osti.gov/servlets/purl/7028755.

@article {osti_7028755,
title = {Возрастная деградация автоматических выключателей Westinghouse на 480 В},
author = {Субудхи, М., Шиер, В. и Макдугал, Э.},
abstractNote = {Оценка старения низковольтных воздушных выключателей Westinghouse серии DS была проведена в рамках программы исследований старения ядерных установок (NPAR).Цели этого исследования - охарактеризовать возрастную деградацию блока выключателя и определить методы технического обслуживания для смягчения их воздействия. Поскольку это исследование было обнародовано в связи с отказами выключателей аварийного отключения реактора на АЭС Макгуайр в июле 1987 г., также обсуждаются результаты, касающиеся сварных швов в сварных швах рычага полюса выключателя. Рассмотрены конструкция и работа выключателей DS-206 и DS-416. Данные об отказах из различных национальных баз данных были проанализированы для определения преобладающих видов отказов, причин и механизмов.Дополнительный опыт эксплуатации одной атомной станции и двух промышленных компаний по обслуживанию выключателей был получен для разработки тенденций старения различных подкомпонентов. Ответы коммунальных предприятий на бюллетень NRC 88-01, в котором обсуждаются сварные швы рычага центрального полюса, были проанализированы, чтобы оценить окончательное устранение отказов сварных швов при отключениях реактора. Были рассмотрены рекомендации по техническому обслуживанию, сделанные производителем для смягчения возрастной деградации, и обсуждены рекомендации по улучшению мониторинга возрастной деградации.Как описано в томе 2 этого NUREG, также включены результаты программы испытаний для оценки разрушения частей выключателя из-за механического цикла. Испытания выявили растрескивание сварных швов рычага центрального полюса, определили методы мониторинга для определения старения выключателей и предоставили информацию для дополнения существующих программ технического обслуживания. Предлагаются рекомендации по повышению надежности выключателя с помощью эффективных программ технического обслуживания, испытаний и проверок. 13 исх., 21 фиг., 8 таб.},
doi = {10.2172 / 7028755},
url = {https://www.osti.gov/biblio/7028755}, журнал = {},
номер =,
объем =,
place = {United States},
год = {1990},
месяц = ​​{7}
}

Энергии | Бесплатный полнотекстовый | Обнаружение переходных неисправностей и их местонахождение в распределительной сети: обзор текущей практики и проблем в Малайзии

1.Введение

Система мониторинга обычно включает в себя управление электросетью с целью контроля и защиты всей сети. Система визуализирует состояние сети и прогнозирует потенциальные сбои в будущем. Наиболее важной частью мониторинга является поддержание бесперебойного электроснабжения, чтобы сократить время отключения электроэнергии из-за неисправностей [1,2]. С конца 1990-х годов малазийская энергоснабжающая компания Tenaga Nasional Berhad (TNB) установила на нескольких подстанциях устройства регистрации неисправностей различных типов для мониторинга важнейших воздушных линий электропередачи.Однако в распределительных фидерах их не было. Система мониторинга в распределительной системе (DS) зависит от срабатывания выключателя и реле на подстанции на основе традиционных методов [3,4]. Как аналог линии передачи, DS состоит из ответвленных боковых сетей или ответвлений, которые доставляют электроэнергию потребителям. Мониторинг неисправностей в DS более сложен из-за такой запутанной конструкции [5,6,7]. Филиалы подвержены различным типам неисправностей, вызванных несколькими источниками, включая климатические условия, отказ оборудования и природные явления.На рисунке 1 показана энергосистема с подключенными сторонами, включая генераторы, энергосистему и распределительную систему в Малайзии. По состоянию на декабрь 2018 года 47% электростанций на полуострове Малайзия состояли из газовых электростанций, 38% угольных, 9% гидроэлектростанций и 1% дизельных электростанций, а остальные 5% приходились на возобновляемые источники энергии, включая крупномасштабные солнечные батареи, мини-гидроэлектростанции и промышленное отходящее тепло. При этой стоимости 23 082 км линий электропередачи и кабелей, включая системы напряжением 500 кВ, 275 кВ и 132 кВ, используются для распределения электроэнергии на 443 подстанции.Затем 113 469 ГВт-ч электроэнергии было распределено 9,039 миллионам потребителей по воздушным распределительным линиям и подземным кабелям. В распределительной системе коммунальные компании пытаются поддерживать работоспособность распределительной сети в соответствии со стандартами мирового класса. Показатели производительности распределительной сети основаны на минимальных затратах на отключение, затратах на командировки и средней продолжительности перебоев в работе системы (SAIDI) [8,9,10]. SAIDI — это показатель количества часов перерыва, которое средний потребитель будет испытывать ежегодно.Более низкое значение SAIDI указывает на меньшую продолжительность неожиданного прерывания и более надежную систему. На рисунке 2 представлено сравнение распределения SAIDI для нескольких стран в 2017 году. Согласно столбчатой ​​диаграмме, наиболее надежные показатели распределения были в Сингапуре с SAIDI 0,56 мин / потребитель / год, в то время как самое высокое значение SAIDI было для Парижа с 61,10 мин / год. потребитель / год, что указывает на наименее надежную систему. В Малайзии показатель SAIDI составил 50,24 мин / потребитель / год, что считается признаком низкой надежности распределительной сети [8].Высокая надежность системы Сингапура объясняется эффективностью обслуживания и прокладки подземных кабелей, что повышает надежность и безопасность электрической сети. Эти факторы были наиболее значимыми в распределительной сети Малайзии из-за сложной инфраструктуры и перегруженности подземных коммуникаций. Среди показателей распределения в Малайзии, штат Путраджая зафиксировал самые надежные показатели распределения с показателем SAIDI 0,73 мин на потребителя в год.Между тем, Пулау Пинанг зарегистрировал самое большое количество прерываний в штате с показателем SAIDI 78,66 мин / потребитель / год, как показано на рисунке 3. Что касается высокого уровня прерываний, для DS жизненно важно эффективно управлять неисправностями. и поддержание качества обслуживания за счет сокращения времени простоя [1,11]. В частности, рост распределенной генерации (ДГ), связанной с сетью, влияет на качество электроэнергии и вызывает существенные проблемы для существующих методов обнаружения и локализации неисправностей [12].Исследователи внесли различные улучшения, чтобы ускорить определение места повреждения [13,14], и была предпринята попытка определить меру определения места повреждения, чтобы объяснить надежность системы мониторинга неисправностей в точном местоположении [15,16]. Мониторинг неисправностей, определяемый как процесс, включает в себя обнаружение, диагностику, изоляцию, а иногда и ремонт неисправных компонентов в DS [17]. Чтобы поддерживать надежность энергоснабжения потребителей, DS должен следовать определенным стандартам, которые включают контроль и работу, отчетность об отключениях и перебоях, мониторинг производительности и координацию безопасности.В таблице 1 представлены рекомендуемые стандарты, относящиеся к мониторингу отказов в системе DS [18]. Стандарты включают измерение и регистрацию изменений величины напряжения, быстрых изменений напряжения, провалов напряжения питания, кратковременных прерываний напряжения питания, переходных процессов, несимметрии напряжения питания и гармонического напряжения [9,19,20,21,22,23,24,25 ]. Кроме того, сочетание вычислительной техники и современных методов беспроводной связи позволяет осуществлять эффективный интеллектуальный мониторинг в режиме реального времени и эффективное управление распределительными системами в рамках интеллектуальных сетей [26,27].Таким образом, эти стандарты обеспечивают выполнение лучших практик с точки зрения связи, передачи данных и мер безопасности [9,28,29,30,31,32] для малазийских DS. Одной из важнейших операций мониторинга в системе распределения является отказ обнаружение и местонахождение. Обнаружение неисправности — это процесс определения того, возникла ли неисправность, путем сравнения параметров оптимального значения с установленным измеренным значением превышения порогового значения [33]. Были приняты различные подходы к обнаружению и локализации неисправностей в DS, без акцента на переходных неисправностях.Переходный КЗ не вызывает беспокойства из-за его самозатравливания, но имеет высокий потенциал, чтобы вызвать короткое замыкание. Кроме того, в определенных ситуациях переходная неисправность может распространяться по кабелю при передаче источника питания. Как следствие, возникает проблема качества электроэнергии, что снижает производительность DS. Из-за ограниченного объема исследований, посвященных кратковременным отказам, не существует конкретных методов, используемых для обнаружения кратковременных отказов в распределительной системе Малайзии. Ранее для обнаружения неисправности применялись обычные методы, основанные на визуальном осмотре.Подход отнимал много времени и требовал квалифицированного инженера для обработки неисправности, если она может привести к большему повреждению системы. С тех пор для решения этих проблем были внедрены различные методы автоматического обнаружения неисправностей. В этой статье рассматривается большинство методов, разработанных и обычно используемых для обнаружения и локализации неисправностей в DS, связанных с переходными помехами. Описываются и сравниваются рабочие принципы, преимущества, недостатки и другие прошлые работы, связанные с каждой техникой.Следовательно, на основе этого обзора возможности в области обнаружения неисправностей и исследования местоположения в системах распределения электроэнергии могут быть дополнительно исследованы. Рисунок 1. Подключенные стороны энергосистемы [34]. Рисунок 1. Подключенные стороны энергосистемы [34]. Рисунок 2. Показатели системы распределения SAIDI для Малайзии и различных городов мира [8,35]. Рисунок 2. Показатели системы распределения SAIDI для Малайзии и различных городов мира [8,35].

Рисунок 3. SAIDI по штатам полуостровной Малайзии в 2017 году.

Рисунок 3. SAIDI по штатам полуостровной Малайзии в 2017 году.

Таблица 1. Рекомендуемый стандарт для мониторинга неисправностей.

Таблица 1. Рекомендуемый стандарт для мониторинга неисправностей.

Установка
Стандарт Название Схема Описание
Стандарт IEC 60909 [9] Токи короткого замыкания в трехфазном A.C. Системы Расчет Максимальные и минимальные предполагаемые токи короткого замыкания в системе для каждого конкретного места и времени
Стандарт IEC 61000-3-6 [19] «Оценка пределов излучения для искажающих нагрузок в Энергетические системы среднего и высокого напряжения » Установка Предел излучения для гармонического излучения в МВ
Стандарт IEC 61000-3-7 [20] « Оценка пределов излучения для колеблющихся нагрузок в энергосистемах среднего и высокого напряжения » Глава 8: «Пределы выбросов для колеблющихся установок, подключенных к системам среднего напряжения»
IEEE-1159 [21] «Рекомендуемая практика для мониторинга качества электроэнергии
»
Измерение и регистрация Глава 5: «Цели мониторинга»
IEEE Std C37.114 ™ -2014 [22] «Руководство по определению места неисправности
на линиях передачи переменного тока и
распределительных линиях»
Измерение и запись Глава 5: «Приложение для поиска других неисправностей»
IEEE Std C37.011 ™ -2011 [23] «Руководство по применению переходного восстанавливающегося напряжения для высоковольтных автоматических выключателей переменного тока» Процедура и расчет Глава 3: «Переходное восстанавливающееся напряжение»
IEEE Std 1894 ™ -2015 [36 ] «Руководство по онлайн-системам мониторинга и регистрации переходных перенапряжений в электроэнергетических системах» Измерение и регистрация Глава 4: «Конфигурация и функции онлайн-систем мониторинга и регистрации переходных перенапряжений в энергосистемах»
IEEE Std 1729 ™ -2014 [24] «Рекомендуемая практика для анализа системы распределения электроэнергии

»
Разработка модели 900 77 Глава 4: «Рекомендации для тестового фидера»
IEEE Std 551 ™ -2006 [37] «Расчет токов короткого замыкания в промышленных и коммерческих энергосистемах» Расчет Глава 12: «Короткое замыкание» расчеты схем в соответствии с международными стандартами »
IEEE Std 399-1997 [25] « Рекомендуемая практика для анализа промышленных и коммерческих систем электроснабжения
»
Измерение и запись Глава 11:« Исследования переходных процессов при коммутации »
IEC 61850 [9] «Стандарт для SCADA» Коммуникация и проектирование Лектор 5: «Стандарт для проектирования автоматизации подстанции»
IEEE 802.15.4 [28] «Стандарт для низкоскоростных беспроводных сетей
»
Связь и установка Глава 5.2.1: «Интеллектуальная коммунальная сеть»
IEC 62351-7 [29] «Связь и информация Management Technologies » Меры безопасности Часть 7: Безопасность через сеть и управление системой
IEC 60870-5 [30] « Функция телеуправления » Связь Часть 5: Профиль связи для отправки базовых сообщений телеуправления между двумя системами, которые используют постоянные каналы передачи данных с прямым подключением между системами.
IEC 60255-24: 2013 и IEEE Std C37.111-2013 [31] «Измерительные реле и защитное оборудование» Обмен данными Часть 24: Общий формат для обмена переходными данными (COMTRADE) для питания системы
ANSI C12-19-2012 [32] «Таблицы данных конечных устройств коммунального хозяйства» Данные приложений Часть 19: Структура таблицы для данных коммунальных приложений, передаваемых между устройством и любым другим устройством
Этот документ организован следующим образом: Краткое объяснение категорий неисправностей и их описание представлено в Разделе 2.Общие типы отказов с упором на несбалансированные КЗ с основными принципами обсуждаются в Разделе 3. В Разделе 4 представлены классы переходных КЗ и их системы защиты, включая общую систему защиты и специфическую молниезащиту. В разделе 5 рассматриваются существующие традиционные методы обнаружения и обработки неисправностей, которые включают методы на основе бегущей волны и импеданса. Обсуждаются принципы работы каждого метода с преимуществами и ограничениями. Кроме того, также рассматриваются методы искусственного интеллекта и обработки сигналов, которые были разработаны на сегодняшний день.В разделе 6 приводится краткое изложение рассмотренного исследования, проблемы, с которыми предстоит столкнуться, и рекомендации относительно будущих методов, которые, как ожидается, будут подходящими для малазийской системы. Наконец, в разделе 7 приводятся различные подходы к обнаружению и локализации неисправностей, которые были разработаны с учетом их преимуществ и ограничений.

4. Переходные отказы в Малайзии

Большинство коротких замыканий, вызывающих временные и постоянные отказы, уязвимы для кратковременных прерываний. Переходные процессы могут быть случайными и варьироваться по степени в зависимости от операционной среды на момент возникновения [48,49].В таблице 2 и на рисунках ниже представлены статистические данные о производительности энергосистемы Малайзии, чтобы указать на ее уязвимость к различным причинам неисправностей, включая переходные. За последние одиннадцать лет (с 2008 по 2018 год) Малайзия зарегистрировала в среднем 78 404 внеплановых отключения в течение года [50,51,52,53,54,55,56,57,58,59,60]. В таблице 2 показан процент незапланированных отключений по причинам неисправности в системе распределения Малайзии. Из таблицы видно, что самый высокий процент причин неисправностей связан с технологическим процессом и качественной работой, которые можно разделить на слабый контакт, неправильное обслуживание и перегрузку.Наименьший процент причин неисправностей приходится на стихийные бедствия, в среднем 0,32%. Стихийное бедствие можно разделить на наводнения, ветер и оползень. Между тем, отказы, вызванные другими событиями, зафиксировали процент прерываний в среднем 1,82%. Другие классы были классифицированы как старение изоляции, короткое замыкание, нарушение целостности, неисправность реле и переходные процессы. На рис. 4 показана гистограмма процента причин неисправностей для более четкого отображения сравнительного значения.Из гистограммы видно, что по другим причинам сбоя (включая кратковременный сбой) в 2017 году был зафиксирован самый высокий процент, который вырос на 98% по сравнению с предыдущими годами. В то же время количество прерываний с 2014 по 2018 год представлено штатами Малайзии, как показано на Рисунке 5. В целом, штат Селангор показывает наибольшее количество прерываний в 2018 году с 15 132 случаями по сравнению с другими штатами. Между тем, Путраджайя показывает наименьшее количество прерываний — всего 14 случаев по сравнению с другими штатами.Статистически переходные процессы известны наименьшим количеством случаев по сравнению с гармониками. Переходные сбои в энергосистеме обычно рассматриваются как незапланированные события, которые обычно вызваны ударами молнии или феноменом переключения. Неисправность обычно представляется как временная неисправность, и она не вызывает особого беспокойства по сравнению с постоянной неисправностью из-за ее самоочищающегося характера и того факта, что она не влияет на операцию восстановления. Однако в случае продолжительной неисправности могут возникнуть перебои в работе и короткое замыкание [61,62].Соответственно, формы сигналов короткого замыкания состоят из переходных сигналов, и чрезмерные скачки тока через систему могут вызвать выход из строя нескольких компонентов системы из-за чрезмерного выделения тепла [63]. Кроме того, возникают некоторые сложные и интересные вопросы, такие как точное моделирование энергосистемы на повышенных частотах и ​​характеристика определенных переходных процессов [64,65,66,67].
4.1. Классы переходных процессов
Существуют два класса переходных процессов, а именно «импульсный переходный процесс» и «колебательный переходный процесс».Первый определяется как «внезапное изменение частоты в установившемся состоянии напряжения, тока или того и другого, которое является однонаправленным по полярности», в то время как второй определяется как «естественный переходный процесс в электроэнергетической системе», который доминирует над импульсным переходный [64]. Типичная продолжительность переходного явления зависит от спектрального состава самого переходного процесса, как определено в IEEE-1159 [68]. В таблице 3 описаны характеристики переходных классов в DS на основе категорий событий.Между тем, описание переходных причин в системе распределения показано в таблице 4.
4.1.1. Импульсные переходные процессы
Импульсные переходные процессы, генерируемые различными источниками, такими как молния, переключение и обрыв проводника (замыкание с высоким импедансом), являются наиболее частыми событиями в системе распределения воздушных линий. Они имеют свои особенности и все чаще используются для предотвращения длительного воздействия. Однако было обнаружено, что импульсные переходные процессы из-за молнии являются основной причиной периодических прерываний и отключений в распределительной системе Малайзии, что является предметом внимания данного исследования.Это связано с тем, что Малайзия находится недалеко от экватора, с экстремальной грозовой активностью около 200 гроз ежедневно [69,70,71,72,73]. Степень увеличения частоты отказов, вызванных ударами молнии, является важным фактором, который следует учитывать при установке изоляции подстанции и определении соответствующей стратегии для ограничения этого перенапряжения. Вспышки молнии могут вызвать сбои и сбои в энергосистеме, если они превышают ограничения нормативного стандарта. Следовательно, показатели качества электроэнергии в такой системе ухудшаются.Из-за всех типов разряда молнии разряд облако-земля (CG) является наиболее опасным для человека, кроме того, электрическое оборудование может быть серьезно повреждено. Большинство разрядов CG происходят последовательно в виде отдельных обратных ходов с амплитудой тока в диапазоне от нескольких кА до более 200 кА, что считается очень высоким [74,75,76,77,78,79].
4.1.2. Колебательный переходный процесс
Колебательный переходный процесс определяется как изменение частоты, не связанное с питанием, в установившемся состоянии.Колебательное поведение тесно связано с нелинейным свойством, полученным из математического определения [80]. Условие выражается либо в напряжении, либо в токе, которое включает значения как отрицательной, так и положительной полярности. Колебательные переходные процессы характеризуются величиной, продолжительностью и спектральным содержанием. Эти прерывания обычно происходят из-за подачи питания во время переключения конденсаторной батареи [81,82].
4.2. Система защиты от переходных отказов
Система защиты состоит из нескольких компонентов, таких как трансформаторы напряжения и тока, защитные реле, автоматические выключатели и каналы связи [83].Основные цели защиты трансформатора основаны на достаточно быстром и надежном реле для изоляции силового трансформатора от сети с минимальным повреждением. Еще одна роль силового трансформатора — предотвращение неправильного срабатывания системы защиты в различных условиях эксплуатации. Было проведено несколько исследований для защиты силовых трансформаторов, таких как измерение напряжения из-за короткого замыкания между двумя разными уровнями напряжения, описание токового сигнала с использованием вейвлетов и коэффициента корреляции, соотношение тока и напряжения на первичной и вторичной клеммах и дифференциальный элемент обратной последовательности мгновенного значения тока [3,84,85,86].Защитное реле идеально подходит для обнаружения проблемы на начальном этапе и устранения возможных повреждений оборудования. Защитное реле связано с автоматическим выключателем, который отключает выключатель при обнаружении неисправности. Схема обнаружения неисправности состоит из реле, которое обнаруживает неисправность в одной из двух зон энергосистемы, разделенных автоматическим выключателем, и инициирует отключение этого выключателя. Однако он не отражает функцию детектора отказа выключателя [87,88].Что касается среды связи, коммунальные предприятия зависят от системы диспетчерского управления и сбора данных (SCADA). Работа при отказе интегрирована с использованием SCADA, и влияние отказов на распределительные системы в целом было определено исследователями [89,90,91]. Когда в фидере происходит сбой, нормальная защита системы изолирует фидер от источника. Процесс включает изоляцию и восстановление, чтобы вернуть систему в нормальное состояние. SCADA требует, чтобы отдельный оператор выезжал к затронутому фидеру и проверял следующее действие.Этот процесс занимает много времени и может повлиять на других потребителей. На рисунке 6 показана конфигурация SCADA для центра управления TNB на электрической подстанции. Мастер устройства Request-To-Send (RTS) передает параметры сигнала, полученные от цифрового регистратора неисправностей, в точках измерения. Затем параметры передаются на центральную станцию. При возникновении неисправности можно одновременно отслеживать сигналы с помощью компьютерного программного обеспечения. Система SCADA будет контролировать с помощью кодированных сигналов для управления устройствами защиты, такими как реле, IED и трансформаторы.Тем не менее, общая система защиты сильно отличается от системы защиты от молний. Перенапряжение молнии может вызвать пробой на воздушной линии, а также нарушение изоляции кабелей и оборудования. Некоторыми эффективными способами снижения частоты пробоев в распределительных воздушных линиях могут быть установка разрядника для защиты от перенапряжения, улучшение изоляции линии и добавление экранированного провода. Защитные устройства обычно содержат один нелинейный элемент, такой как разрядник из оксида металла (MO), конденсаторы или старый карбид кремния (SiC), чтобы ограничить переходное перенапряжение и отвести импульсный ток.Все эти мотивы для защиты воздушных линий заключаются в том, чтобы свести к минимуму вероятность кратковременных прерываний и провалов напряжения из-за пробоев от молнии [92,93]. Для выбора правильной системы молниезащиты требуется определение параметров молнии. Эти параметры включают в себя:
  • Форма тока молнии — пиковое значение, время фронта, время хвоста и продолжительность.

  • Полярность.

  • Кратность количества компонентов во флэш-памяти.

Для оценки эффективности изоляции электроэнергетического оборудования при испытаниях на выдерживаемое импульсное напряжение стандартом IEC предусмотрен стандартный грозовой импульс с временем фронта / спада волны 1,2 / 50 мкс [94,95,96, 97]. На основании IEC 62350–1 Ed. 2 [98,99], оценка тока молнии первого обратного хода показана на рисунке 7. На графике I 0 представляет пиковое значение тока, t 0 — время фронта, t 1 — время до 10% от пикового значения, t 2 — это время до 90% от пикового значения, t h — общее время до половины значения пика (время хвоста), t max — время до пиковое значение, T 1 — длительность фронта, а T 2 — (виртуальное) время до половины значения [94].

Таблица 4. Описание кратковременных причин в системах распределения.

Таблица 4. Описание кратковременных причин в системах распределения.

Событие Описание
Переключение конденсаторов [21,36,63,64,65]
  • Конденсатор, используемый в DS для увеличения коэффициента мощности и снижения потерь в линии.

  • Повышение напряжения при переключении равно 1.В 5–2 раза больше номинального напряжения.

  • Переходный процесс спектра вызывает всплеск при включении конденсатора, в то время как более одного действия переключения могут привести к перекрывающимся переходным процессам.

  • Переходное напряжение, увеличивающееся из-за переключения, не должно превышать 2 о.е., что считается безопасным состоянием.

Молния [67,68,69,70,71,72,73,97,98,99]
  • Экстремальная грозовая активность в Малайзии.

  • Разряд молнии создает разность потенциалов между линиями электропередач и землей.

  • Может повредить приборы и сократить срок службы электрического оборудования.

  • Количество энергии очень велико и вызывает перенапряжение.

  • Необходимо для установки грозозащитного разрядника.

Высокий импеданс
Неисправность [100,101,102,103,104,105,106]
  • Из-за разрыва питающего проводника и его физического контакта с такими поверхностями, как листья, камень или песок.

  • Величина напряжения становится ниже, в результате чего создается низкий ток, близкий к уровню тока нагрузки.

  • Не обнаруживается системой защиты, такой как реле и предохранители.

Что такое исследование координации защитных устройств

Правильно спроектированные системы позволят открыться только ближайшему к месту повреждения защитному устройству, оставив остальную часть системы нетронутой и сохранив непрерывность обслуживания.Для правильного выбора и настройки защитных устройств энергосистем для достижения этой цели требуется исследование координации защитных устройств. Это достигается путем выполнения оценки тока времени среди защитных устройств.

Координация, как правило, представляет собой компромисс между взаимно желательными, но в некоторой степени несовместимыми целями максимальной защиты и максимальной непрерывности обслуживания. При использовании литых автоматических выключателей обычно невозможно координировать систему в мгновенной области из-за перекрытия кривых, если не используется блокировка зон.По этой и другим причинам, таким как установленный дизайн системы, многие комбинации настроек устройства могут быть классифицированы как приемлемые. Настройки, предлагаемые в исследовании расчета опасности дугового разряда, являются результатом оценки наилучшего баланса между конкурирующими целями.

Рекомендации по настройке защитных устройств включены в раздел исследования координации исследования по расчету опасности вспышки дуги. Чтобы показать, как были получены эти рекомендации, включены графики времени-текущих характеристик для этих устройств.

Резюме координационного исследования

Согласование устройств защиты от сверхтоков рассматривается для каждой однолинейной схемы. Выбор время-токовой характеристики (TCC) представляет те условия, которые потенциально создают наихудшие условия координации. В общем, координация может быть достигнута в зонах перегрузки устройств защиты от перегрузки по току (OCPD), однако только ограниченная координация обычно достигается в мгновенной области. В результате исследования координации можно отметить следующее.

  1. Временные кривые тока, представленные в исследовании, показывают, что все кабели и все трансформаторы надлежащим образом защищены устройствами защиты от сверхтоков. Настройки, выбранные для автоматических выключателей, являются попыткой обеспечить наилучшую возможную защиту для устройств, находящихся ниже по цепи, при попытке сохранить избирательную координацию.
  2. Полная координация системы может или невозможна из-за выключателей в литом корпусе с фиксированной кривой, которые имеют мгновенные характеристики отключения, расширяющиеся до отключающей способности OCPD.При более высоких уровнях тока короткого замыкания действует мгновенная область характеристики OCPD. Токи повреждения могут протекать через множество OCPD, что приводит к открытию нескольких OCPD. В этом случае области мгновенного действия выключателей перекрываются. Значение имеющегося тока повреждения вызовет отключение OCPD на стороне нагрузки, однако за время, необходимое для устранения неисправности, вышестоящий OCPD отключается и также размыкается. В некоторых случаях может открыться несколько устройств. Это верно для комбинаций автоматических выключателей с другими автоматическими выключателями и / или токоограничивающими предохранителями, которые могут воспринимать токи короткого замыкания в пределах их токоограничивающего диапазона.Некоторые автоматические выключатели распределительной панели имеют фиксированные характеристики и не могут быть отрегулированы для улучшения координации. Если автоматические выключатели имеют фиксированные характеристики, это указано в таблице рекомендуемых настроек автоматического выключателя.
  3. Дополнительные проблемы координации возникают из-за наличия нескольких защитных устройств одинакового размера в одной цепи, где номинальные значения тока последовательно соединенных OCPD идентичны. Это типично для автоматических выключателей, защищающих фидеры к панельным платам, и для щитовой панели, имеющей главный автоматический выключатель того же номинального тока.Эти устройства не могут координироваться. В этом случае нет согласования как в области перегрузки, так и в мгновенной области.
  4. Там, где предусмотрены автоматические выключатели с электронным расцеплением, возможность установки кратковременных задержек и уставок срабатывания улучшает координацию. Если можно выполнить настройку на мгновенную область автоматического выключателя, он должен учитывать максимальную координацию с другими OCPD. Если OCPD находится на первичной стороне трансформатора, необходимо учитывать пусковой ток возбуждения трансформатора.Если применимо, нанесены кривые повреждения трансформатора и пусковой ток.
  5. Все согласования выключателя были проанализированы и предоставлены с учетом уровня энергии вспышки дуги. Предлагаемые настройки обеспечивают наилучшую координацию при минимальном уровне энергии падающей дуги.

Настройки регулируемых автоматических выключателей отключения в системе обобщены в исследовании. После просмотра отчета настройки, рекомендованные в исследовании, должны быть выполнены на соответствующих устройствах.Для дальнейшего обсуждения системной координации, будет сделана ссылка на кривые время-ток и соответствующие комментарии в исследовании.

Согласование защитных устройств, как установлено в отчете, требует, чтобы рабочие характеристики индивидуальных защитных устройств не отклонялись заметно от тех, которые показаны на графиках тока времени. Указанные настройки будут обеспечивать работу защитных устройств в основном так, как показано. Для низковольтных расцепителей прямого действия и предохранителей диапазоны допусков допускают отклонения в рабочих характеристиках.Однако допуски защитного реле и сложность точной настройки на месте могут привести к отклонениям от указанного времени срабатывания. Поэтому рекомендуется откалибровать настройки реле с помощью полевых испытаний, чтобы получить желаемый отклик реле, а также калибровать и проверять через регулярные промежутки времени в будущем.

Все автоматические выключатели одинаковы?

% PDF-1.6 % 45 0 объект > эндобдж 41 0 объект [/ CalGray>] эндобдж 42 0 объект [/ CalRGB>] эндобдж 56 0 объект > поток 11.08.5102018-08-20T01: 42: 52.694-04: 00Acrobat PDFWriter 3.02 для Windows 41.000-05: 00application / pdf2018-08-20T01: 55: 43.188-04: 00

  • Eaton
  • Все автоматические выключатели одинаковы?
  • uuid: c6a4378f-7283-42e7-a948-4bdf62e9b313uuid: 0cce7b16-c15a-48f0-a34c-d1b4324aa662 Среда, 19 февраля 2003 г. 2:38:31 PMAcrobat PDFWriter 3.02 для Windows среда, 19 февраля 2003 г. 14:38:31
  • eaton: супермаркеты / рынки / здравоохранение / центр знаний
  • eaton: ресурсы / маркетинговые ресурсы / официальные документы
  • eaton: страна / северная америка / сша
  • eaton: супермаркеты / рынки / здравоохранение
  • eaton: language / en-us
  • конечный поток эндобдж 38 0 объект > эндобдж 39 0 объект > эндобдж 40 0 объект > эндобдж 17 0 объект > / ProcSet 34 0 R >> / Повернуть 0 / Тип / Страница >> эндобдж 19 0 объект > / ProcSet 34 0 R >> / Повернуть 0 / Тип / Страница >> эндобдж 21 0 объект > / ProcSet 34 0 R >> / Повернуть 0 / Тип / Страница >> эндобдж 23 0 объект > / Повернуть 0 / Тип / Страница >> эндобдж 24 0 объект > поток HVRHíf = ;, h @ -yZ ~ n / 8B * m ߾9 jp) Coa4S`sh3Al ײ Q0WWzR0 $

    ρ: `Mfѿ0xF2 & # w (at Z’v ^ ~ vXfHMeS3Aw ߮͟ k2, «IQF0 = D $ fSOӽo99bY.& semC? lze # kau4LO സ s ~ | / r3XdML8j [‘ۢ cҵkИgDw; G4 \ ZU% HX6 «k8iV% zuQiG? dV 8nmT70 [6nk4ͪ, 6g> d | (v%

    Субстратное ингибирование 5β-Δ4-3-кетостероиддегидрогеназы в Sphingobium sp. Штамм Chol11 действует как прерыватель цепи во время роста с помощью токсичных желчных солей

    Abstract

    В отличие от многих стероидных гормонов и холестерина, желчных солей млекопитающих представляют собой 5β-стероиды, что приводит к изогнутой структуре стероидного ядра.Соли желчных кислот представляют собой поверхностно-активные стероиды, которые в больших количествах выделяются в окружающую среду, где они подвергаются бактериальному разложению.Разложение бактериальных стероидов инициируется окислением A-кольца, что приводит к образованию канонических Δ 4 -3-кетостероидов с двойной связью в A-кольце. Для 5β-солей желчных кислот эта Δ 4 -двойная связь вводится в 3-кето-желчные соли с помощью 5β-Δ 4 -кетостероиддегидрогеназы (5β-Δ 4 -KSTD). С белком Nov2c019 из желчных солей, разлагающим Sphingobium sp. штамм Chol11, новый 5β-Δ 4 -KSTD для деградации солей желчных кислот, принадлежащий к семейству Old Yellow Enzyme, был идентифицирован и назван 5β-Δ 4 -KSTD1.Гетерологичная продукция в Escherichia coli , функция 5β-Δ 4 -KSTD может быть показана для 5β-Δ 4 -KSTD1, а также гомолога CasH из желчных солей, разлагающих Rhodococcus jostii RHA1. Мутант с делецией 5β-Δ 4 -kstd1 имел длительную лаг-фазу с холатом в качестве единственного источника углерода и, в соответствии с функцией 5β-Δ 4 -KSTD1, демонстрировал замедленную трансформацию 3-кетохолата. Очищенный 5β-Δ 4 -KSTD1 был специфичен для 5β-стероидов в отличие от 5α-стероидов и преобразованных стероидов с различными гидроксигруппами независимо от наличия боковой цепи.5β-Δ 4 -KSTD1 показал относительно низкую K m для 3-кетохолата, очень высокую удельную активность и выраженное субстратное ингибирование. Что касается токсичности солей желчных кислот, эти кинетические свойства указывают на то, что 5β-Δ 4 -KSTD1 может обеспечить быструю детоксикацию детергентного свойства, а также предотвратить переполнение катаболического пути в присутствии повышенных концентраций солей желчных кислот.

    Ключевые слова: метаболизм бактерий, желчная кислота, биодеградация, дегидрогеназа, флавопротеин, стероид

    Введение

    Желчные соли, такие как холат ( 1 дюйм), являются важным классом стероидных соединений у позвоночных, которые помогают переваривать жир. пищевые соединения (Hofmann et al., 2010). Обычно соли желчных кислот имеют боковую карбоновую цепь C 5 , присоединенную к C17 стероидного скелета, и гидроксильную группу у C3; многие соли желчных кислот также имеют одну или две дополнительные гидроксильные группы, присоединенные к атомам углерода 6, 7 или 12 соответственно. Соли желчных кислот млекопитающих представляют собой 5β-стероиды с кольцами A и B в конфигурации цис (Hofmann et al., 2010), что приводит к изогнутой структуре молекулы со всеми гидроксильными группами на одной стороне (α-стороне), тем самым создавая амфифильная молекула с моющими свойствами ().При экскреции в окружающую среду выделяется большое количество солей желчных кислот, например, до 0,4–0,6 г солей желчных кислот в день на каждого человека (Ridlon et al., 2006). В окружающей среде соли желчных кислот являются богатыми углеродом и электронами субстратами для гетеротрофных бактерий, таких как Rhodococcus jostii, RHA1, Pseudomonas stutzeri, Chol1, а также Sphingobium sp. штамм Chol11, ранее Novosphingobium sp. штамм Chol11 (Philipp et al., 2006; Philipp, 2011; Horinouchi et al., 2012; Mohn et al., 2012; Holert et al., 2014; Bergstrand et al., 2016).

    Конформация и структуры стероидов из разных функциональных классов с различной стереохимией в C5 (A) и первые стадии деградации бактериальных стероидов, а именно окисление A-кольца до канонических Δ 1,4 -3-кетостероидов (B) . HSD, гидроксистероиддегидрогеназа; KSTD, 3-кетостероиддегидрогеназа; Hsh3, гидроксистероиддегидратаза Sphingobium sp. штамм Chol11.Синие точки: C5. * Эта реакция имеет место только для 7-гидроксистероидов и у специализированных организмов, таких как Sphingobium sp. штамм Chol11.

    Как детергенты, соли желчных кислот очень токсичны для бактерий. Экспозиция приводит к повреждению клеточных мембран, белков и ДНК (Helenius, Simons, 1975; Begley et al., 2005; Merritt, Donaldson, 2009; Cremers et al., 2014). Следовательно, бактерии, разлагающие или трансформирующие соли желчных кислот, должны быть способны защитить себя от этих токсических эффектов (Gunn, 2000; Philipp et al., 2006). Хотя разложение само по себе служит механизмом детоксикации, бактерии, разлагающие соли желчных кислот, неизбежно должны подвергаться воздействию этих соединений, поскольку они должны быть поглощены до ферментативного разложения. Эта дилемма требует особых стратегий при использовании этих токсичных детергентов в качестве субстрата для роста. С одной стороны, оттокные насосы могут использоваться для поддержания низкого внутриклеточного уровня солей желчных кислот. Они обнаруживаются во многих кишечных бактериях, устойчивых к солям желчных кислот, таких как Escherichia coli (Thanassi et al., 1997; Ганн, 2000; Venter et al., 2015), но до сих пор не были доказаны на бактериях, разлагающих желчные соли.

    С другой стороны, ферментативная трансформация солей желчных кислот должна быстро аннулировать детергентный характер. В отличие от ограниченных знаний о белках для оттока (и поглощения) солей желчных кислот у бактерий, разлагающих соли желчных кислот, известны многие ферменты, участвующие в соответствующих катаболических путях разложения солей желчных кислот. Бактериальное разложение солей желчных кислот происходит аэробно по так называемому пути 9,10- seco (; Philipp et al., 2006; Филипп, 2011; Mohn et al., 2012) и следует общей схеме (Philipp, 2011; Horinouchi et al., 2012; Wipperman et al., 2014; Olivera, Luengo, 2019): (1) окисление A-кольца до Δ 1,4 -3-кето-структуры с двумя двойными связями в A-кольце (синий в), (2) деградация боковой цепи, аналогичная β-окислению (зеленый в), (3) расщепление колец A и B за счет оксигенации (желтый в) и (4) гидролитического разложения оставшихся колец C и D (оранжевый в). В хорошо выясненном Δ 1,4 -варианте этого пути, как происходит, т.е.g., у P. stutzeri Chol1, Δ 1,4 -3-кетостероиды являются субстратами для расщепления кольца (Bergstrand et al., 2016). Напротив, вариация 7-гидрокси-желчных солей через Δ 4,6 -кетостероиды и впоследствии Δ 1,4,6 -3-кетостероиды обнаружена в α-протеобактериях, принадлежащих к сфингомонад в основном исследованы на Sphingobium sp. штамм Chol11 (Holert et al., 2014;). Sphingobium sp. штамм Chol11 был выделен из пресной воды с использованием Δ 4,6 -3-кето-желчной соли 12-гидрокси-3-оксохол-4,6-диеноата (HOCDA, 11 дюйм) в качестве субстрата.Штамм способен разлагать различные соли желчных кислот, но ограничен в использовании нестероидных источников углерода (Yücel et al., 2016). В обоих вариантах разложения 7-гидроксильных солей желчных кислот холат сначала окисляется до Δ 4 -3-кетохолата ( 6 дюйм). В отличие от введения второй двойной связи в A-кольцо в варианте Δ 1,4 , в варианте Δ 4,6 вода удаляется из B-кольца 7α-гидроксистероиддегидратазой Hsh3. . Это приводит к введению двойной связи у C6 в HOCDA ( 11 in; Yücel et al., 2016). HOCDA далее разлагается до Δ 1,4,6 -3-кето-C 17 -стероид ( 12 ), но механизмы деградации боковой цепи и расщепления кольца еще не выяснены в Sphingobium sp. штамм Chol11.

    Участок аэробного разложения стероидов модельного субстрата холата через Δ 1,4 -вариант и Δ 4,6 -вариант пути 9,10- seco , как обнаружено в Pseudomonas stutzeri Chol1 и Sphingobium sp.штамм Chol11 соответственно. Непрерывные стрелки указывают на известные реакции, пунктирные стрелки указывают на реакции, предсказанные в результате биоинформатического анализа, но не подтвержденные экспериментально. Цвета стрелок указывают на участок деградации стероидов: синее окисление A-кольца, зеленая деградация боковой цепи, желтое расщепление B-кольца и деградация колец A и B, оранжевый деградация колец C и D. 12β-DHADD, 7α, 12β- дигидроксиандроста-1,4-диен-3,17-дион; THSATD, 3,7,12-тригидрокси-9,10- seco -андроста-1,3,5-триен-9,17-дион; 3αOH-HIP, 3aα-OH-4a (30-пропаноат) -7aβ-метилгексагидро-1-инданон; HOCDA, 12-гидрокси-3-оксохола-4,6-диеноат; HATD, 12β-гидроксиандроста-1,4,6-триен-3,17-дион; DHSATD, 3,12-дигидрокси-9,10- seco -андроста-1,3,5,6-тетраен-9,17-дион.

    Образование Δ 4 -двойных связей в молекулах стероидов достигается различными реакциями в зависимости от субстрата (). В стероидах, имеющих двойную связь у C5 (таких как холестерин, 3 дюйм), двойная связь Δ 4 вводится путем изомеризации двойной связи C5 комбинированной гидроксистероидной дегидрогеназой (HSD) и изомеразой (Yang et al. , 2007; Uhía et al., 2011; Kreit, 2017). В стероидах, не имеющих двойной связи в A- или B-кольце Δ 4 -двойные связи вводятся Δ 4 -кетостероиддегидрогеназами (Δ 4 -KSTD).Эти ферменты подразделяются на 5α-Δ 4 -кетостероиддегидрогеназу и 5β-Δ 4 -кетостероиддегидрогеназы (5β-Δ 4 -KSTD), действующие на стероидные скелеты с плоской структурой 5α [например, дигидротестостерон ( 2 дюйм)] по сравнению с изогнутой 5β-структурой [такой как холат ( 1 дюйм)]. Описаны различные 5α-Δ 4 -кетостероиддегидрогеназы (Dijkstra et al., 2016): KstD4 из Rhodococcus erythropolis SQ1, KstD из R.jostii RHA1 (van Oosterwijk et al., 2012) и TesI из Comamonas testosteroni (Florin et al., 1996).

    Большинство солей желчных кислот у млекопитающих и других позвоночных, таких как змеи, а также желчные спирты у хрящевых рыб являются 5β-стероидами (Hofmann et al., 2010). 5β-конформация также может быть обнаружена в гормонах насекомых экдистероидного типа и в стероидных токсинах, таких как дигитоксин или батрахотоксин; Еще одним источником 5β-стероидов в окружающей среде является копростанол, продукт микробной трансформации холестерина у многих животных и людей (Bull et al., 2002; Жерар, 2013). К настоящему времени только один 5β-Δ 4 -KSTD был очищен и охарактеризован из стероид-разлагающей бактерии в 1966 году (Davidson and Talalay, 1966). Было описано, что этот флавоэнзим из C. testosteroni окисляет 5β-3-кетостероиды без или с боковой цепью C 2 , в то время как соли 3-кето-желчных кислот в качестве субстратов не тестировались. Последовательность этого белка неизвестна. Таким образом, невозможно было предсказать или обнаружить никаких гомологов от других бактерий, разлагающих соли желчных кислот.Два фермента с активностью 5β-Δ 4 -KSTD в отношении 3-кето-желчных солей были описаны из Clostridium scindens (Kang et al., 2008; Funabashi et al., 2020), которые преобразуют, но не разлагают желчь. соли в кишечнике человека. Во время этого так называемого восстановительного дегидроксилирования гидроксильные группы удаляются из C7. Одним из этапов этого процесса является введение двойной связи Δ 4 (Ridlon et al., 2006). Было описано, что BaiCD и BaiH из C. scindens катализируют эту реакцию со специфичностью для 7α-гидроксильных солей желчных кислот, таких как холат или хенодезоксихолат, и 7β-гидроксильных солей желчных кислот, таких как урсодезоксихолат, соответственно (Kang et al., 2008). Хотя активность 5β-Δ 4 -KSTD можно легко измерить в клеточных экстрактах бактерий, разлагающих соли желчных кислот, P. stutzeri Chol1 (Birkenmaier et al., 2007) и Sphingobium sp. штамм Chol11 (Holert et al., 2016) с искусственными акцепторами электронов, не обнаружены 5β-Δ 4 -KSTD для солей желчных кислот, которые участвуют в первых этапах деградации стероидов и, таким образом, детоксикации солей желчных кислот, и охарактеризован до сих пор. Поэтому нашей целью было идентифицировать этот фермент в желчной соли, разлагающей Sphingobium sp.Chol11 с помощью протеомного анализа и изучения его роли в детоксикации солей желчных кислот.

    Материалы и методы

    Культивирование бактерий

    Штаммы и плазмиды, использованные в этом исследовании, перечислены в. Штаммы Sphingobium sp. штамм Chol11 (DSM 110934; Holert et al., 2014), P. stutzeri Chol1 (DSM 103613; Philipp et al., 2006), Pseudomonas putida KT2440 (DSM 6125; Bagdasarian et al., 1981), R. jostii RHA1 (McLeod et al., 2006) и Escherichia coli MG1655 (DSM 18039; Blattner et al., 1997) выращивали в буферной минеральной среде B (MB) HEPES, как описано ранее (Jagmann et al., 2010; Holert et al., 2014 ). E. coli ST18 (DSM 22074; Thoma and Schobert, 2009) и E. coli Tuner (DE3) (Novagen, Merck, Дармштадт, Германия) культивировали в среде бульона для лизогенизации (LB; Bertani, 1951). В то время как окисление 3-кетобильных солей было испытано на штаммах, разрушающих соли желчных кислот Sphingobium sp.штамм Chol11, P. stutzeri Chol1 и R. jostii RHA1, E. coli MG1655 использовали для гетерологичной экспрессии немаркированных предполагаемых 5β-Δ 4 -KSTD и E. coli Tuner использовали для производства меченного гистом 5β-Δ 4 -KSTD для очистки. Ауксотрофный штамм с 5-аминолевулиновой кислотой E. coli ST18 использовали для переноса плазмид в другие штаммы путем бипарентской конъюгации. Штамм P. putida KT2440 использовали для получения стероидных соединений.

    Таблица 1

    Штаммы и плазмиды, использованные в этом исследовании. Cm r , Ap r , Gn r и Kn r : устойчивость к хлорамфениколу, ампициллину, гентамицину или канамицину соответственно.

    jostii RHA1 pDM вектор замены, Ap r , sacB
    Штамм Описание Литература
    Sphingobium sp. штамм Chol11 Штамм, разлагающий желчные соли Holert et al., 2014, DSM 110934
    Штамм Chol11 Δ 5β-Δ 4 -kstd1 Делеционный мутант 5β-904 904 kstd1 Это исследование
    P.stutzeri Chol1 Деградирующий штамм желчных солей Philipp et al., 2006, DSM 103613
    Штамм Chol1 Δ c211_11427 Делеционный мутант c211_11427 c211_11427 Штамм, разлагающий желчные соли McLeod et al., 2006
    P. putida KT2440 Производство производных желчных солей Bagdasarian et al., 1981, DSM 6125
    E. coli ST18 Клонирование, 5-Ala ауксотрофный, pro thi hsdR + Tpr Smr; хромосома :: RP4-2 Tc :: Mu-Kan :: Tn7 / λpir Δ hemA Thoma and Schobert, 2009, DSM 22074
    E. coli MG1655 Экспрессия и тестирование различных генов-кандидатов , прототрофный, F , лямбда , rph-1 Blattner et al., 1997, DSM 18039
    E.coli Tuner (DE3) Производство белка, ompT hsdS B (r B m B ) галлонов dcm lacY1 (DE3)
    Плазмида Характеристики Ссылки
    pDM4 Вектор замещения гена, Cm r , sacB Milton 900EX4 Gene, 1996 4
    Hoang et al., 1998
    pBBR1MCS-5 Вектор экспрессии гена, Gn r Kovach et al., 1995
    pET28B (+) Вектор экспрессии гена, Kn r Novagen

    Для поддержания штаммов штаммы дикого типа P. stutzeri Chol1, Sphingobium sp. штамм Chol11 и R. jostii RHA1 выращивали с 1 мМ холатом в качестве источника углерода, тогда как мутанты с делецией Sphingobium sp.штамм Chol11 и E. coli MG1655 выращивали с 15 мМ глюкозы, а делеционные мутанты P. stutzeri Chol1, а также P. putida KT2440 выращивали с 12 мМ сукцинатом. В случае прекультур и основных культур для суспензий клеток Sphingobium sp. Chol11 и E.coli, MG1655, глюкоза была добавлена, тогда как сукцинат был добавлен для соответствующих культур штаммов P. stutzeri Chol1 и P. putida KT2440.

    Для культивирования E. coli ST18 добавляли 50 мкг мл -1 5-аминолевулиновой кислоты. Для культивирования штаммов, содержащих pBBR1MCS-5, добавляли 20 мкг, мл -1 гентамицина, при добавлении солей желчных кислот и в основных культурах экспериментов по выращиванию гентамицин не добавляли. Для культивирования штаммов, содержащих pDM4, добавляли 30–90 мкг мл –1 хлорамфеникола. Escherichia coli штаммов, содержащих pEX18AP, выращивали в присутствии 100 мкг / мл -1 ампициллина, тогда как P.stutzeri , содержащие pEX18AP, выращивали в присутствии 100 мкг мл -1 карбенициллина. Штаммы, содержащие pET28B (+), культивировали с 50 мкг мл -1 канамицина.

    Для чашек с агаром к соответствующей среде добавляли 1,5% (мас. / Об.) Агар Бакто (BD, Sparks, США). Жидкие культуры в пробирках или колбах Эрленмейера инкубировали при 30 ° C и 200 или 120 об / мин соответственно, а планшеты инкубировали при 37 ° C для штаммов E. coli и 30 ° C для всех остальных штаммов.

    Эксперименты по выращиванию

    Для экспериментов по выращиванию 5 мл прекультуры в 10 мл пробирки инокулировали из чашек с агаром и инкубировали в течение ночи в течение примерно 20 часов. Предварительные культуры использовали для инокуляции 3-5 мл среды в пробирках объемом 10 мл с различными источниками углерода, как указано, до оптической плотности при 600 нм (OD 600 ) около 0,2. Оптическую плотность измеряли при 600 нм (Camspec M107, Spectronic Camspec, Великобритания) для определения роста. Для измерения супернатантов с помощью высокоэффективной жидкостной хроматографии (ВЭЖХ) образцы отбирали в заданные моменты времени.

    Экспериментальные процедуры для профилирования растворимых белков с помощью двумерного разностного гель-электрофореза (2D DIGE) описаны в дополнительном тексте S1 в дополнительном материале.

    Эксперименты с суспензией клеток

    Для экспериментов с суспензией клеток с Sphingobium sp. штамм Chol11 и делеционные мутанты, прекультуры готовили, как описано выше, и инкубировали в течение примерно 20 часов. Около 50 мл основных культур в колбе Эрленмейера на 500 мл инокулировали до OD 600 = 0.015 и инкубировали около 40 часов. Клетки собирали в фазе экспоненциального роста центрифугированием в течение 8 мин при 8000 × g, и 4 ° C. После промывки средой без источника углерода клетки ресуспендировали в среде без источника углерода и разбавляли до OD 600 , равного 1. Суспензии клеток делили на аликвоты по 5 мл в 10-миллилитровые пробирки. К суспензии клеток добавляли около 10 мкг мл -1 хлорамфеникола, как указано. Для начала эксперимента к суспензии добавляли 1 мМ холат, и образцы для высокоэффективной жидкостной хроматографии в сочетании с масс-спектрометрией (ВЭЖХ-МС) отбирали немедленно и в заранее определенные моменты времени во время инкубации.

    Для оценки токсичности холата последний добавляли к суспензиям клеток в заданных концентрациях, и количество колониеобразующих единиц (КОЕ) определяли через 15 и 90 мин при 30 ° C методом капель и чашек после десятичного разведения, как описано (Hoben и Сомасегаран, 1982; Ягманн и др., 2010).

    Методы клонирования и конструирование немаркированных делеций генов

    Методы клонирования были выполнены, как описано в другом месте (Holert et al., 2013a; Yücel et al., 2016).

    Для гетерологичной экспрессии гены 5β-Δ 4 -kstd1 , nov2c085 и nov2c314 из Sphingobium sp. штамм Chol11, c211_11247 и c211_11427 из P. stutzeri Chol1, а также casH из R. jostii RHA1 были амплифицированы с помощью ПЦР с использованием геномной ДНК соответствующего штамма дикого типа в качестве матрицы и пара праймеров expfor / exprev (). Вектор pBBR1MCS-5 (Kovach et al., 1995), а также амплифицированный ген были обработаны рестрикционными ферментами, как описано и лигированы. Препараты лигирования использовали для трансформаций теплового шока с E. coli, ST18 или MG1655. Из E. coli ST18 плазмиды были перенесены в E. coli MG1655 или P. putida KT2440 путем конъюгации, как описано для P. stutzeri Chol1 (Holert et al., 2013a). В качестве контроля были сконструированы пустые векторные контроли всех штаммов, содержащие только pBBR1MCS-5 без вставки.Трансформации и конъюгации проверяли с помощью ПЦР с использованием материала колоний в качестве матрицы и секвенирования с использованием праймеров M13.

    Таблица 2

    Праймеры, используемые для клонирования и конструирования делеций немаркированных генов.

    90 062 я Я девяносто одна тысяча сто шестьдесят восемь + +
    Имя Последовательность Ограничение на сайте
    expfor_Chol1_3αHSD TTTTTTGGATCCATGTCCGTTATCGCAATTA Bam Привет
    exprev_Chol1_3αHSD TTTTTTGAATTCTCAGAAGACCTTGGTCCGCA Eco RI
    expfor_Chol1_c211_11427 TTTTTTTCTCGAGATGCCCGACTATTCGCACCT Xho Я
    exprev_Chol1_c211_11427 TTTTTTTTCTAGATCAAACCCTCAACGCCACCT Хва Я
    expfor_RHA1_casH TTTTTTTAAGCTTATGACGATAGATCTCGACCCGCC Hind III
    exprev_RHA1_casH TTTTTTTTCTAGATCACGGCACGCGAAGCAC Хва Я
    expfor_Chol11_5β-Δ 4 -kstd1 TTTTTTTCTCGAGATGACTGCTGCCCCTGCCCT Xh О
    exprev_Chol11_5β-Δ 4 -kstd1 TTTTTTTTCTAGATCAGCGGCCCATGGCGG Xba I
    expfor_Chol11_nov2c085 TTTTTTTCTCGAGATGGCTTACCGCCACCTCCT Xho I
    exprev_Chol11_nov2c085 TTTTTTTTCTAGATCATCCGATCGCGGCGACGG Xba
    expfor_Chol11_nov2c314 TTTTTTTCTCGAGATGGAATTGCGCAACCGGAT Xho I
    exprev_Chol11_nov2c314 TTTTTTTTCTAGATCACCCGGCTATTGCGTCCA Xba I
    purfor_Chol11_5β-Δ 4 -kstd1 TTTTTTTCATATGACTGCTGCCCCTGCCCT Nde I
    purrev_Chol11_5β-Δ 4 -kstd1 TTTTTTCTCGAGTGAGCGGCCCATGGCGG Xho I
    upfor_CholΔ11_5β-Δ 4 -kstd1 TTTTTTTTCTAGAGTAGAGGTGGAGCGGAATC Xba I
    uprev_Chol11_5β-Δ 4 -kstd1 TCTGATCTTCAAGGCCAAAG
    dnfor_Chol11_5β-Δ 4 -kstd1 CTTTGGCCTTGAAGATCAGAGAGAGTCTCCTAATTCGCCA
    dnrev_Chol11_5β-Δ 4 -kstd1 TTTTTTTCTCGAGCTACGACAACCCGGTCAACA Xho I
    upfor_Chol1_c211_11427 TTTTTTTTCTAGATGGGACGGGACCAAATTACG Xba I
    uprev_Chol1_c211_11427 GGTAGGTGGATGAAAAAGAAAGCC
    dnfor_Chol1_c211_11427 TTCTTTTTCATCCACCTACCGTTTCGTTCCTTGCGATGGGG
    dnrev_Chol1_c211_11427 TTTTTTTCTCGAGCGGGTCGAAAAGCTGATCCT 904 for_Chol1_stdA1 TTTTTTTTCTAGACTCACGCAATCACGCCACTC Хва Я
    uprev_Chol1_stdA1 CTGCCGTTCCCCTGTCACCA
    dnfor_Chol1_stdA1 TGGTGACAGGGGAACGGCAGCAGCGCCTCACGCAGCGGCG
    dnrev_Chol1_stdA1 TTTTTTTCTCGAGGACGTGGTCCCAGCCAGGCA Xho Я
    upfor_Chol1_kstd1 TTTTTTTCTAGAACCAACAACTCCAGCCTCG Хва Я
    uprev_Chol1_kstd1 GTCCGACTCACTTGCCAGGTT
    dnfor_Chol1_kstd1 AACCTGGCAAGTGAGTCGGACGGAGCGACCGATGAATGCACG
    dnrev_Chol1_kstd1 TTTTTTAAGCTTATGGAGGTAACCGAGGCGA Hind III
    М13 для (- 43) AGGGTTTTCCCAGTCACGACGTT
    М13 оборотов (-49) GAGCGGATAACAATTTCACACAGG
    pDM4_MCS_for ACTTAACGGCTGACATGGGA
    pDM4_MCS_rev GCGAAGTGATCTTCCGTCAC
    T7_for TAATACGACTCACTATAGGG
    T7_rev TATGCTAGTTATTGCTCAG
    pDM4_backbone_for AAG ATG TGG CGT GTT ACG GT
    pDM4_backbone_rev AGG CTC TGG GAG AGG CTC TGG GAG GCA GAA_Backbone_for
    TTTTTTTCCCGGGTCGGCATTTTCTTTTGCGTT

    Немаркированные делеционные мутанты Sphingobium sp.штамм Chol11 и P. stutzeri Chol1 были созданы, как описано (Holert et al., 2013a; Yücel et al., 2016), с использованием сплайсинга методом перекрывающегося удлинения (SOE) PCR (Ho et al., 1989) и пар праймеров upfor / uprev и dnfor / dnrev для амплификации фланкирующих фрагментов. Встраивание pDM4 (Milton et al., 1996) в геном было подтверждено методом ПЦР колоний с использованием пары праймеров pDM4_backbone_for / pDM4_backbone_rev. Для делеции kstD1 в P. stutzeri Chol1 вместо pDM4 суицидный вектор pEX18AP (Hoang et al., 1998) и пара праймеров sacB_for / sacB_rev. Делецию гена подтверждали с помощью ПЦР колоний с парой праймеров upfor / dnrev, и мутанты с делецией выделяли повторным выделением одиночных колоний и тестированием ПЦР. Мутант с делецией был протестирован с помощью ПЦР с использованием выделенной геномной ДНК, а также с последующим секвенированием (дополнительный рисунок S8).

    Для пополнения Sphingobium sp. штамм Chol11 Δ 5β-Δ 4 -kstd1 , пустой вектор pBBR1MCS-5 и вектор комплементации pBBR1MCS-5 :: 5β-Δ 4 -kstd1 , как описано выше, были перенесены из E.coli ST18 в Sphingobium sp. штамм Chol11 дикого типа и Δ 5β-Δ 4 -kstd1 путем конъюгации, как описано в другом месте (Yücel et al., 2016).

    Приготовление клеточных экстрактов

    Клеточные экстракты пустого вектора E. coli MG1655 pBBR1MCS5, а также с различными вставками были приготовлены для ферментных анализов. Предварительные культуры всех штаммов в LB с 20 мкг мл -1 гентамицина инкубировали при 30 ° C в течение примерно 8 часов. Около 50 мл LB с 20 мкг мл -1 гентамицина и 0.2 мМ изопропил-β-D-тиогалактопиранозид (IPTG) в колбах Эрленмейера на 500 мл без перегородок инокулировали прекультурой до OD 600 0,015 и инкубировали в течение ночи в течение примерно 16 часов. Клетки собирали центрифугированием при 8000 × g в течение 8 минут и комнатной температуре и промывали 10 мМ буфером MOPS (pH 7,8 с NaOH). Клетки ресуспендировали в 2 мл 50 мМ буфера MOPS (pH 7,8) в 15 мл конических пробирках для центрифугирования. Разрушение клеток проводили на льду с помощью ультразвука (UP200S, Hielscher Ultrasonics, Teltow, Германия) с амплитудой 60% и циклом 0.5 по 2 раза по 4 мин с перерывом 2 мин. Экстракты клеток переносили в реакционные пробирки на 2 мл и остатки клеток удаляли центрифугированием в течение 30 мин при 25000 × g и 4 ° C. Супернатанты делили на аликвоты и либо использовали напрямую, либо хранили при -20 ° C.

    Очистка 5β-Δ

    4 -KSTD1

    Для очистки фермента 5β-Δ 4 -KSTD1, 5β-Δ 4 -kstd1 амплифицировали с использованием геномной ДНК сфингобия .штамм Chol11 дикого типа в качестве матрицы и пара праймеров purfor_Chol11_5β-Δ 4 -kstd1 / purrev_Chol11_5β-Δ 4 -kstd1 (). Фрагмент клонировали в вектор экспрессии pET28b (+) (Novagen, Merck, Дармштадт, Германия) с помощью рестрикционных ферментов () и лигирования. Продукт лигирования переносили в E.coli ST18 путем трансформации тепловым шоком, и наличие вставки проверяли с помощью ПЦР колоний с парой праймеров T7_for / T7_rev и последующим секвенированием. Плазмиду перенесли в E.coli Tuner (DE3) путем конъюгации, как описано выше для E. coli MG1655. Правильный перенос плазмиды подтверждали с помощью ПЦР колоний с парой праймеров T7_for / T7_rev. Клеточные экстракты E. coli Tuner (DE3) pET28B (+) :: 5β-Δ 4 -kstd1 были приготовлены и протестированы на активность 5β-Δ 4 -KSTD.

    Для получения 5β-Δ 4 -KSTD1, 2 л среды LB в четырех 2-литровых колбах Эрленмейера без перегородок инокулировали из прекультуры и инкубировали при 37 ° C и орбитальном встряхивании 120 об / мин.При OD 600 около 0,3 добавляли 0,2 мМ IPTG и снижали температуру до комнатной. После 16 ч дальнейшей инкубации клетки собирали центрифугированием в течение 15 минут при 8000 × g, и 4 ° C, промывали 10 мМ MOPS pH 7,8 и ресуспендировали в 30 мл 50 мМ MOPS pH 7,8. Суспензии клеток хранили при -75 ° C в течение ночи до разрушения клеток. Клетки размораживали на льду и после добавления 100 мкл 10 мг -1 лизоцима и 0,05% Triton X100 разрушали ультразвуком (UP200S, Hielscher Ultrasonics, Teltow, Германия) с амплитудой 60% и циклом 0.5 четыре раза по 3 мин на льду. Клеточный экстракт центрифугировали в течение 8 минут при 7000 × g, и 4 ° C и в течение дополнительных 59 минут при 19000 × g, и 4 ° C для удаления остатков клеток. Супернатант фильтровали через шприцевой фильтр из ПВДФ 0,45 мкм (Carl Roth, Карлсруэ, Германия). Меченый белок очищали с использованием колонки HisTrap HP объемом 5 мл и FPLC (Äkta start, оба GE Healthcare, Чикаго, Иллинойс, США). Колонку уравновешивали 20 мМ Трис-буфером, pH 8, с 200 мМ NaCl и 6 мМ имидазолом.Свободный от клеток лизат загружали в колонку, которую затем промывали 15 объемами колонки 20 мМ Трис-буфера pH 8 с 200 мМ NaCl и 6 мМ имидазолом. Меченый белок элюировали градиентом от 100% 20 мМ Трис-буфера с pH 8 с 200 мМ NaCl и 6 мМ имидазола до 60% 20 мМ Трис-буфера с pH 8 с 200 мМ NaCl и 250 мМ имидазолом. Фракции, содержащие белок, собирали, объединяли и концентрировали с помощью центрифужного концентратора с отсечкой молекулярной массы 10 кДа (Vivaspin, Sartorius, Göttingen, Германия).Белок освобождали от имидазола путем диализа в 2 л 20 мМ MOPS pH 7,8 при 4 ° C в течение ночи.

    SDS-PAGE для определения чистоты белка выполняли в соответствии со стандартными процедурами, как описано в другом месте (Ernst et al., 2020). Спектр поглощения 5β-Δ 4 -KSTD1 определяли с помощью нанофотометра (Implen, Мюнхен, Германия), а концентрацию флавина оценивали с использованием коэффициента экстинкции 12000 M -1 см -1 ( Ghisla et al., 1974). Кофакторы флавина 5β-Δ 4 -KSTD1 отделяли от белка денатурированием белка в 50% метаноле. Денатурированный белок удаляли центрифугированием в течение 5 минут при> 16000 × g и комнатной температуре, и супернатант измеряли с помощью ВЭЖХ-МС.

    Enzyme Assays

    Концентрацию белка определяли с помощью набора для анализа BCA (Pierce, Thermo Scientific, Rockford, IL, United States).

    Если не указано иное, ферментные анализы с очищенным ферментом проводили в 50 мМ буфере MOPS, pH 7.8 с NaOH, с 1 мМ K 3 Fe (CN) 6 в качестве акцептора электронов и начинали с добавления 0,5 мМ 3-кетохолата в качестве субстрата. Для предварительных тестов анализы проводились в кюветах из полистирола объемом 1 мл (Sarstedt, Nümbrecht, Германия) и содержали 25 мкг мл -1 фермента 5β-Δ 4 -KSTD1, тогда как большинство других анализов, если не указано иное, проводили в полистироле. 96-луночные планшеты с плоским дном (Sarstedt, Nümbrecht, Германия) с 12,5 мкг мл -1 5β-Δ 4 -KSTD1 и коррекция длины пути после подтверждения сопоставимости активностей в обеих системах.Активность фермента измеряли при 436 нм на спектрофотометре (UV-2600, Shimadzu, Киото, Япония) при 30 ° C для кювет и при 450 нм в нагреваемом считывающем устройстве для микропланшетов (EL808, Biotek, Winooski, VT, США) при 30 ° C. ° C для микропланшетов. Коэффициенты экстинкции для K 3 Fe (CN) 6 составляли 0,7 см -1 мМ -1 при 436 нм и 0,262 см -1 мМ -1 при 450 нм согласно литературным данным и собственным измерениям (Зингер, 1974; Биркенмайер и др., 2007).Для определения оптимального pH анализы проводили с 50 мМ Трис-буфером, доведенным до различных значений pH с помощью NaOH или HCl или буфера Макилвейна (McIlvaine, 1921) при различных значениях pH. Подгонку кинетики фермента в соответствии с соответствующими моделями выполняли с помощью Excel Solver с использованием модели Левенберга-Марквардта для кинетической модели Michealis-Menten для ингибирования субстрата. Эта модель эквивалентна модели неконкурентного ингибирования, в которой концентрации субстрата и ингибитора приравниваются (уравнение 1).Стандартные отклонения для биохимических констант были определены на основе 95% доверительных интервалов аппроксимации.

    v = vmax × SKm + S × 1 + IKi; S = I

    (1)

    Уравнение (1) используется для подбора стационарной кинетики Δ 4 -5β-KSTD1. Концентрация субстрата ([ S ]) также используется для концентрации ингибитора ([ I ]).

    Растворы 5α-3-кетолитохолата, 5β-3-кетолитохолата, 5α-андростан-3,17-диона и 5β-андростан-3,17-диона получали в ДМСО с концентрацией около 25 мМ.В ферментных анализах использовали около 0,5 мМ этих субстратов после подтверждения того, что 5β-Δ 4 -KSTD1 не ингибировался 2% (об. / Об.) ДМСО. Анализы, содержащие эти субстраты, проводили в 1 мл 50 мМ MOPS в 1,5 мл реакционных пробирках и инкубировали при 30 ° C в течение 30 мин. Конечные образцы измеряли с помощью ВЭЖХ-МС и сравнивали с контролями без фермента. Для определения K M с 5β-андростан-3,17-дионом анализы проводили в микропланшетах, как описано, с 4% (об. / Об.) ДМСО во всех анализах после подтверждения отсутствия 4% ингибирующего эффекта (об. / v) на 5β-Δ 4 -KSTD1.

    Для анализов с другими акцепторами электронов анализы объемом 1 мл проводили в реакционных пробирках на 1,5 мл с 0,5 мМ 3-кетохолата и 12,5 мкг мл -1 5β-Δ 4 -KSTD1. Около 1 мМ K 3 Fe (CN) 6 , NAD + или NADP + , 25 мкМ феназинметосульфат (PMS), 100 мкМ 2,6-дихлорфенолиндофенол (DCPIP) или отсутствие акцептора электронов для O Добавляли 2 контрольных образца и инкубировали анализы при 30 ° C и 30 мин и инактивировали нагреванием перед измерением с помощью ВЭЖХ-МС.

    Ферментные анализы с 1 мМ НАДФН или НАДН, примерно 0,2 мМ Δ 4 -3-кетохолат и 25 мкг мл -1 5β-Δ 4 -KSTD1 были выполнены и измерены с помощью ВЭЖХ-МС для проверки обратимости реакции. Анализы с 0,5 мМ K 3 Fe (CN) 6 , 0,1 мМ 3-кетохолата и 25 мкг мл -1 5β-Δ 4 -KSTD1 были дополнены поверхностно-активными веществами [холат, додецилсульфат натрия (SDS) или Tween20] в различных концентрациях, чтобы исключить ингибирование белка за счет поверхностно-активных свойств 3-кетохолата вместо ингибирования субстрата.

    Ферментные анализы с клеточными экстрактами E. coli MG1655 проводили с 1 мг / мл общего белка -1 и 1 мМ K 3 Fe (CN) 6 в реакционном объеме 1 мл в реакционных пробирках на 1,5 мл . Экстракты клеток предварительно инкубировали с 1 мМ холатом в течение 30 мин при 30 ° C перед большинством ферментных анализов, чтобы предотвратить катализируемое ферментом E. coli окисление 7-гидроксигруппы на 3-кетохолате субстрата. В эти анализы добавляли 0,5 мМ 3-кетохолата, 0,25 мМ 3-кетолитохолата или 240 мкл супернатанта биотрансформации, содержащего 3-кетохенодезоксихолат, 3-кетодезоксихолат или 3-кетурсодезоксихолат.

    Для определения положения двойной связи добавляли клеточный экстракт E. coli MG1655 pBBR1MCS-5 :: hsh3 (0,4 мг / мл -1 ), и анализы инкубировали при 30 ° C в течение дополнительных 30 минут. мин. Все анализы были измерены с помощью ВЭЖХ-МС.

    Получение стероидных соединений

    Холат (≥99%) из желчи быка или овцы, а также дезоксихолат (≥97%) и 3-β-гидрокси-5α-холан-24-оат были приобретены у Sigma-Aldrich (St Луис, Миссури, США). Хенодезоксихолевая кислота (≥98%) и урсодезоксихолат были приобретены у Carl Roth GmbH + Co.KG (Карлсруэ, Германия) и Fluorochem (Хадфилд, Великобритания) соответственно. 3-Кетохолат был приобретен в Chemcruz (Santa Cruz Biotechnology, Даллас, Техас, США). 5α-3-кетолитохолат, 5β-3-кетолитохолат, 5α-андростан-3,17-дион и 5β-андростан-3,17-дион были приобретены у Steraloids (Ньюпорт, Род-Айленд, США).

    3-кетодезоксихолат, 3-кетохенодезоксихолат и 3-кетурсодезоксихолат получали биотрансформацией с помощью P. putida KT2440 pBBR1MCS-5 :: 3αhsd Chol1 из гена P.stutzeri Chol1, кодирующий 3α-HSD, доступ Refseq {«type»: «entrez-protein», «attrs»: {«text»: «WP_008568627.1», «term_id»: «495844048», «term_text»: «WP_008568627.1»}} WP_008568627.1) из дезоксихолата, хенодезоксихолата или урсодезоксихолата соответственно. Для этой цели штамм инкубировали с 1 мМ соответствующей соли желчных кислот в 5 мл среды MB с дополнительными 24 мМ сукцината в качестве источника углерода при 30 ° C в реакционных пробирках в течение нескольких дней, пока не появится значительное количество соответствующего 3-кето -бильную соль, как подтверждено с помощью ВЭЖХ-МС.Для ферментных анализов использовали культуральный супернатант после центрифугирования в течение 5 минут при> 16000 × g и температуре окружающей среды. Δ 4 -3-Кетохолат был продуцирован биотрансформацией 1 мМ холата P. stutzeri Chol1 Δ stdA1 Δ kstD1 (с делециями гена стероидной CoA лигазы StdA1, номер доступа Ref_1140 c2 «type»: «entrez-protein», «attrs»: {«text»: «WP_008568657.1», «term_id»: «495844078», «term_text»: «WP_008568657.1 «}} WP_008568657.1 и для 3-кетостероид-Δ 1 -дегидрогеназа KstD1, доступ Refseq {» type «:» entrez-protein «,» attrs «: {» text «:» WP_054094687.1 «,» term_id «:» 929556578 «,» term_text «:» WP_054094687.1 «}} WP_054094687.1) в 50 мл МБ с дополнительными 12 мМ сукцината в колбах Эрленмейера на 500 мл без перегородок. Культуры инкубировали до полного превращения холата в Δ 4 -3-кетохолат. Супернатанты собирали центрифугированием в течение 8 мин при 8000 × g и комнатной температуре и фильтровали через фильтр 0.Фильтр шприца 2 мкм перед использованием.

    Аналитические методы

    Для измерения стероидов методом ВЭЖХ-МС отбирали образцы из ферментных анализов, а также культуры и центрифугировали в течение 5 минут при> 16000 × g . Супернатанты либо непосредственно использовали для измерений, либо хранили при -20 ° C и снова центрифугировали перед измерением.

    ВЭЖХ-МС измерения проводились с помощью ВЭЖХ Dionex Ultimate 3000 (ThermoFisher Scientific, Уолтем, Массачусетс, США) с матричным детектором УФ / видимого света и масс-спектрометром с ионной ловушкой (Amazon speed, Bruker; Бремен, Германия) ) с источником ионов с электрораспылением (ESI).ВЭЖХ была оборудована обращенно-фазовой колонкой C18 (Eurospher II 100-5, 150 × 3 мм, размер частиц 5 мкм; Knauer, Берлин, Германия). Вводили 20 мкл образца при температуре 25 ° C и использовали в качестве элюентов ацетонитрил и 10 мМ ацетат аммония с 0,1% муравьиной кислотой. Градиентный метод, начиная с 0,3 мл мин. -1 10% ацетонитрила в течение 2 мин, увеличивая до 90% ацетонитрила за 22 мин, выдерживая 1 мин при 90% ацетонитриле и возвращаясь к 10% ацетонитрилу через 1 мин при 0,4 мл мин. — 1 с последующим уравновешиванием в течение 4 мин при 10% ацетонитриле и 0.4 мл мин. -1 использовалось для всех измерений. МС работал в режиме ультрасканирования в диапазоне сканирования 50–1000 Да со следующими настройками: поток сухого газа 12 л мин. -1 и температура сухого газа 200 ° C, газ распылителя 22,5 фунта на кв. Дюйм, чередование полярности, торцевая пластина смещение 500 В и капиллярное напряжение 4000 В.

    Концентрацию холата определяли по хроматограмме базового пика в отрицательных измерениях МС и стандартных кривых. Концентрации промежуточных продуктов разложения стероидов определяли как площади пиков в произвольных единицах.3-Кетохолат количественно определяли по хроматограмме основного пика в отрицательном режиме МС-измерений, Δ 4 -3-кетохолат и Δ 1,4 -3-кетохолат определяли по УФ-хроматограммам при 245 нм, тогда как HOCDA определяли из 290 нм УФ-хроматограммы для большинства экспериментов и хроматограммы экстрагированных ионов для m / z 385 в отрицательном режиме для экспериментов по выращиванию из-за интерференции с неизвестным промежуточным продуктом. Для идентификации аналитов использовались молекулярные массы и УФ-спектры поглощения, а также время удерживания.

    Оценка физиологической четвертичной структуры 5β-Δ 4 -KSTD1 была выполнена гель-фильтрацией на увеличивающей колонке 10/300 Superdex 200 (GE Life Sciences, Чикаго, Иллинойс, США) с буфером, содержащим 20 мМ MOPS, pH 7,8 и 150 мМ NaCl. Хроматографию выполняли на установке ÄKTA FPLC при потоке 0,5 мл мин. -1 и детектировании при 280 нм. Калибровку молекулярной массы проводили с использованием смеси тиреоглобулина, бычьего γ-глобулина, куриного овальбумина, конского миоглобина и аденозилкобаламина в качестве эталонных соединений (BioRad, Hercules, Калифорния, США).

    Биоинформатические методы

    Для поиска гомологов использовали BLASTp (Altschul et al., 1990; Johnson et al., 2008). Для поиска гомологов с известной структурой или с опубликованными характеристиками использовали поиск BLAST в RCSB PDB (Berman et al., 2002) и paperBLAST (Price, Arkin, 2017). Прогнозирование белковых доменов выполняли с помощью Interpro (Mitchell et al., 2019). Выравнивания филогенетических деревьев рассчитывали в MegaX (Kumar et al., 2018) с помощью алгоритма ClustalW (Thompson et al., 1994). Филогенетические деревья были рассчитаны в MegaX с использованием метода максимальной экономии и начальной проверки с 50 повторениями. Присутствие железо-серного кластера было предсказано с помощью Interpro, сравнений и metalpredator (Valasatava et al., 2016). Выравнивания геномной ДНК дикого типа и делеционных мутантов рассчитывали с использованием алгоритма Needleman-Wunsch в пакете BLAST (Needleman and Wunsch, 1970; Johnson et al., 2008).

    Результаты

    Анализ протеома выявил кандидата на 5β-Δ

    4 -KSTD

    Во время протеомного анализа Sphingobium sp.штамм Chol11, белок (Nov2c019, UniProt ID UPI000BE3811D) с 28% идентичностью BaiCD из C. scindens {«type»: «entrez-protein», «attrs»: {«text»: «VPI12708», «term_id» «:» 16457 «,» term_text «:» VPI12708 «}} VPI12708 (Kang et al., 2008) выделяется. Этот белок кодируется на хромосоме рядом с ферментами, функция которых предсказывается в окислении стероидного А-кольца (Yücel et al., 2018b). Количественный протеомный анализ (2D DIGE) выявил 5,5-кратное увеличение количества Nov2c019 во время роста Sphingobium sp.штамм Chol11 с холатом по сравнению с клетками, выращенными на глюкозе (дополнительные таблицы S1, S2). Nov2c019 имел только низкое сходство (17% идентичности для каждого) с известными Δ 1 -KSTD и 5α-Δ 4 -KSTD, такими как TesH и TesI, соответственно, из C. testosteroni .

    Nov2c019 проявляет активность KSTD при гетерологической экспрессии

    Для дальнейшего выяснения функции Nov2c019 его ген был экспрессирован из плазмиды в E. coli MG1655. В ферментных анализах с 3-кетохолатом ( 5 дюйм) в качестве субстрата, K 3 Fe (CN) 6 в качестве акцептора электронов и клеточным экстрактом E.coli MG1655 pBBR1MCS-5 :: nov2c019 , стероидное соединение на 2 Да легче, чем 3-кетохолат, с характеристическим поглощением при 245 нм, указывающим на двойную связь в A-кольце (Holert et al., 2013b) () . Для определения положения двойной связи добавляли клеточный экстракт E. coli MG1655 pBBR1MCS-5 :: hsh3 . Hsh3 представляет собой 7-гидроксистероиддегидратазу из Sphingobium sp. штамм Chol11, который стереоспецифически катализирует отщепление воды от 7α-гидроксильных групп в желчных солях с 3-кетогруппой и Δ 4 -двойной связью (Yücel et al., 2016). При добавлении этого клеточного экстракта образовалась HOCDA ( 11 ), на что указывает ее характерное поглощение при 290 нм и молекулярная масса 385 Да для депротонированной кислоты (Holert et al., 2014). Этот результат с Hsh3 в качестве диагностического инструмента показывает, что первая двойная связь должна была находиться в Δ 4 -положении, поскольку это является предпосылкой для образования Δ 4,6 -3-кетостероидных соединений с такой характеристической абсорбцией. Таким образом, Nov2c019 может катализировать десатурацию связи C-C между атомами углерода 4 и 5 в 5β-стероиде и, соответственно, был назван 5β-Δ 4 -KSTD1.

    Характеристики очищенного 5β-Δ 4 -KSTD1. (A) УФ / видимый спектр поглощения. (B) Желтый раствор очищенного 2,48 мг / мл -1 5β-Δ 4 -KSTD1. (C) MS хроматограмма основного пика супернатанта 5β-Δ 4 -KSTD1, денатурированного 50% метанолом, с указанием FAD и FMN в качестве кофакторов. Во время измерений HPLC-MS поглощение измеряли в диапазоне 200–320 нм.

    3D-УФ-хроматограмма, показывающая Δ 4 -3-кетохолат ( 6 дюйм) и HOCDA ( 11 ) в ферментном анализе с 3-кетохолатом в качестве субстрата, экстракты клеток Escherichia coli MC1655- pBBR1 5 :: 5β-Δ 4 -kstd1 , а также E.coli MG1655 pBBR1MCS-5 :: hsh3 и K 3 Fe (CN) 6 в качестве акцептора электронов. Образцы анализировали с помощью высокоэффективной жидкостной хроматографии в сочетании с масс-спектрометрией (ВЭЖХ-МС), и стероидные соединения определяли на основании времени удерживания, спектра поглощения и массы. Массы указаны для соответствующих депротонированных кислот.

    Очищенный 5β-Δ

    4 -KSTD1 эффективно окисляет 5β-3-кетостероиды до соответствующих Δ 4 -3-кетостероидов

    Для дальнейшей характеристики 5β-Δ 4 -KSTD1 фермент был очищен.Используя his-теги как на C-, так и на N-конце из-за его большого размера, фермент можно выделить с помощью аффинной хроматографии (дополнительный рисунок S2). Биоинформатический анализ предсказал относительно большой белок около 75 кДа, принадлежащий к семейству старых желтых ферментов. Эти анализы также предсказали наличие двух кофакторов флавинов, а также кластер [4Fe-4S], включающий цистеины C375, C378, C381 и C393. В соответствии с этим очищали белок с массой чуть более 70 кДа (дополнительный рисунок S1), максимумами поглощения, характерными для кофакторов флавина, при примерно 260 и 450 нм () и соответствующей желтой окраской ().В 2 раза более высокая концентрация флавина примерно 70 мкМ по сравнению с концентрацией белка 2,48 мг / мл -1 (соответствует примерно 33 мкМ) указывает на стехиометрию двух кофакторов флавина на молекулу фермента. Измерения ВЭЖХ-МС подтвердили, что денатурация фермента высвобождает кофакторы флавина, которые были идентифицированы как FAD и FMN с помощью MS (). Гель-фильтрация очищенного белка показала, что в основном присутствовали молекулы с массой 70 кДа, что указывает на то, что 5β-Δ 4 -KSTD1 является мономерным ферментом (дополнительный рисунок S2).

    Каталитическая активность 5β-Δ 4 -KSTD1 по отношению к различным стероидам с ( A + B ) или без ( C + D ) боковой цепью и 5β- ( A + C ) или 5α- ( B + D ) структура. УФ-хроматограммы ферментных анализов с 5β-Δ 4 -KSTD1, K 3 Fe (CN) 6 в качестве акцептора электронов и 5β-3-кетолитохолатом ( 14 , A) , 5α-3-кетолитохолатом ( 18 , B) , 5β-андроста-3,17-дион ( 16 , C) или 5α-андроста-3,17-дион ( 19 , D ) в качестве субстратов .Анализы синего фермента, содержащие субстрат, акцептор электронов и 5β-Δ 4 -KSTD1, черные контроли без 5β-Δ 4 -KSTD1. Второй пик, обнаруженный в ферментных анализах с 5β-3-кетолитохолатом (A) , связан с неидентифицированным загрязнением без характерного максимума поглощения при 245 нм. Ферментные анализы анализировали с помощью ВЭЖХ-МС, и стероидные соединения идентифицировали по времени удерживания, спектру поглощения и массе. 15 : Δ 4 -3-кетолитохолат, 17 : Δ 4 -андростен-3,17-дион.Как 5α-, так и 5β-андроста-3,17-дион, а также 5α и 5β-3-кетолитохолат не обнаруживают поглощения при 245 нм и, следовательно, не видны на УФ-хроматограммах.

    В ферментных анализах с K 3 Fe (CN) 6 в качестве акцептора электронов очищенный 5β-Δ 4 -KSTD1 полностью преобразовал 3-кетохолат ( 5 дюйм) в Δ 4 -3-кетохолат ( 6 ; дополнительная фигура S3A), и добавление клеточного экстракта, содержащего Hsh3, снова привело к образованию HOCDA ( 11 ), подтверждая, что продукт представляет собой Δ 4 -3-кетохолат (дополнительная фигура S3B).

    Для анализа субстратного спектра 5β-Δ 4 -KSTD1 в качестве субстратов в анализах активности ферментов использовали 5α-, а также 5β-стероиды с боковой цепью и без нее, но с идентичной структурой (). 5β-Δ 4 -KSTD1 был способен окислять стероиды, имеющие 5β-ядро как с боковой цепью, так и без нее, а именно 3-кетолитохолат ( 14 дюйм) и 5β-андростан-3,17-дион ( 16 😉 к Δ 4 -3-кетолитохолату ( 15 ) и андрост-Δ 4 -ен-3,17-диону ( 17 ) соответственно.Напротив, соответствующие 5α-эквиваленты 5α-3-кетолитохолата ( 18 😉 и 5α-андростан-3,17-диона ( 19 😉 не были преобразованы. В ферментных анализах, тестирующих различные 3-кето-желчные соли в качестве потенциальных субстратов, 5β-Δ 4 -KSTD1 был способен катализировать окисление других 3-кето-желчных солей с различными гидроксильными группами, присоединенными к стероидному ядру, до соответствующих продуктов Δ 4 -3-кетохенодезоксихолат ( 20 на дополнительном рисунке S4A), Δ 4 -3-кетодезоксихолат ( 21 ; дополнительный рисунок S4B) и Δ 4 -3-кетоурсодезоксихолат (дополнительный 22-кетоурсодезоксихолат (22) Рисунок S4C).

    Каталитические свойства 5β-Δ 4 -KSTD1. (A) Кинетика 5β-Δ 4 -KSTD1. Активность с различными концентрациями 3-кетохолата ( 5 дюйм) и 1 мМ K 3 Fe (CN) 6 при pH 7,8 (черный) и моделирование кинетики ингибирования субстрата с данными константами (синий). (B) Ингибирующее действие детергентов холата (черный) и Tween20 (синий) на ферментативную активность 5β-Δ 4 -KSTD1 с 0,2 мМ 3-кетохолата и 1 мМ K 3 Fe (CN) 6 . (C) Специфичность 5β-Δ 4 -KSTD1 в отношении акцепторов электронов. Конечные концентрации продукта Δ 4 -3-кетохолат в ферментных анализах с использованием 5β-Δ 4 -KSTD1, 0,5 мМ 3-кетохолата и различных акцепторов электронов. Контроль не содержал акцептора электронов, кроме кислорода из воздуха, который обнаруживается во всех анализах. Концентрации акцепторов электронов составляли 1 мМ NAD + , 1 мМ NADP + , 1 мМ K 3 Fe (CN) 6 , 25 мкМ PMS, 100 мкМ DCPIP.Ферментные анализы анализировали с помощью ВЭЖХ-МС, и стероидные соединения идентифицировали по времени удерживания, спектру поглощения и массе. (D) Влияние pH на активность фермента 5β-Δ 4 -KSTD1 с 0,5 мМ 3-кетохолата в качестве субстрата в буфере Tris-Cl. Планки погрешностей указывают SD, которые могут быть не видны, если они слишком малы ( n = 3).

    Кроме того, в ферментных анализах, содержащих НАДН или НАДФН в качестве доноров электронов, а также Δ 4 — 3-кетохолат в качестве субстрата (данные не показаны).

    5β-Δ

    4 -KSTD1 показывает ингибирование субстрата

    Путем мониторинга изменений абсорбции при восстановлении K 3 Fe (CN) 6 активность фермента 5β-Δ 4 -KSTD1 может быть определена фотометрически. С 1 мМ K 3 Fe (CN) 6 кинетика показала максимальную активность с примерно 0,1 мМ 3-кетохолата ( 5 дюйм). Более высокие концентрации органического субстрата привели к сильному снижению скорости, что указывает на ингибирование субстрата ().Действительно, с использованием кинетической модели субстратного ингибирования Michealis-Menten, которая эквивалентна модели неконкурентного ингибирования, в которой концентрации субстрата и ингибитора приравниваются, данные могут быть описаны точно. Подгонка Левенберга-Марквардта привела к v max примерно 134,8 ± 50,7 ммоль минимум -1 мг -1 , K м = 15,6 ± 32,6 мкм и K i = 416,3 ± 250,1 мкМ. Предполагая чистоту субстрата 100%, эти параметры дают k cat из 16.9 ± 6.3 × 10 4 с −1 . Стандартные отклонения были рассчитаны на основе 95% доверительных интервалов, полученных с помощью алгоритма подбора, который является более точным, чем, например, усреднение параметров из трех повторных сопоставлений и вычисление соответствующих SD на их основе (Sheskin, 2007). Возможной причиной ингибирующего действия 3-кетохолата может быть его детергентный характер, который может влиять на функциональность фермента. Поэтому мы провели тесты для определения общей чувствительности фермента к неспецифическому ингибированию, вызванному детергентом.При концентрации 3-кетохолата 0,2 мМ не было обнаружено активности с 35 мкМ SDS (данные не показаны). Однако в присутствии 45 мМ [5% (об. / Об.)] Неионного детергента Tween20 активность снизилась только на 20% (). Холат ( 1 дюйм) показал очень сильное зависимое от концентрации ингибирование фермента, приводящее к потере около 95% активности при использовании 5 мМ холата и напоминающее ингибирование, обнаруживаемое при более высоких концентрациях 3-кетохолата (). Эти данные показывают, что 5β-Δ 4 -KSTD1 не страдает общей чувствительностью к поверхностно-активным соединениям, но помимо 3-кетохолата ингибируется другими солями желчных кислот.

    Рост Sphingobium sp. штамм Chol11 wt (черный) и Δ 5β-Δ 4 -kstd1 (синий) с холатом ( 1 дюйм; A ), разложением холата ( B ) и накоплением промежуточных продуктов 3-кетохолата ( 5 дюйм, C ), Δ 4 -3-кетохолат ( 6 , D ) и HOCDA ( 11 , E ) в бесклеточном культуральном супернатанте. Планки погрешностей указывают на SD и могут не отображаться, если они слишком маленькие ( n = 3).

    Для анализа кинетики фермента с 5β-стероидом без боковой цепи использовали 5β-андростан-3,17-дион ( 16 дюйм). Однако не наблюдалось увеличения активности с увеличением концентрации субстрата, возможно, потому что насыщение субстрата уже достигается при концентрациях ниже предела обнаружения спектрофотометрического анализа (то есть очень низкий K m 5β-Δ 4 — KSTD1 с 5β-андростан-3,17-дионом, дополнительный рисунок S5A). Активность фермента около 6 ммоль мин. -1 мг -1 была ниже по сравнению с 3-кетохолатом, и ингибирования субстратом не наблюдалось.Однако ферментные анализы были ограничены низкой растворимостью субстрата в воде и неоднозначным определением концентрации из-за ограниченной чистоты коммерческого субстрата.

    Для анализа возможных акцепторов электронов были протестированы NAD + , NADP + , PMS и DCPIP, а также контроль без дополнительного акцептора электронов, кроме атмосферного O 2 (). В анализах, содержащих PMS и K 3 Fe (CN) 6 , 0,5 мМ 3-кетохолат ( 5 дюйм) полностью трансформировался после 30 мин инкубации при 30 ° C.В анализах, содержащих DCPIP, это превращение было намного менее эффективным и достигало только 25% превращения с K 3 Fe (CN) 6 . В анализах с НАД + или НАДФ + в качестве акцепторов электронов конверсия была еще менее эффективной и не отличалась от анализов, в которых только кислород из воздуха мог служить акцептором электронов.

    Оптимальное значение pH для 5β-Δ 4 -KSTD1 было определено равным примерно 8 () при использовании 50 мМ трис-Cl буфера. Соответственно, активность фермента линейно увеличивалась с pH от 5.5–8 при использовании буфера Макилвейна (дополнительный рисунок S5B).

    Фенотип немаркированного мутанта с делецией

    5β-Δ 4 -kstd1 демонстрирует пониженное окисление 3-кетохолата до Δ 4 -3-кетохолат

    Немаркированный делеционный мутант 9038 Sph39 соответствующего гена Sph. . штамм Chol11 Δ 5β-Δ 4 -kstd1 , был сконструирован и показал лишь незначительную, но в нескольких биологических повторностях очень стабильно замедленный рост с холатом ( 1 дюйм) в качестве единственного источника углерода с лаг-фазой примерно на 1 час по сравнению с к дикому типу без лаг-фазы ().Эта длительная лаг-фаза не наблюдалась, когда клетки выращивали с глюкозой (данные не показаны). Оба штамма имели одинаковые скорости роста и достигали одинаковой конечной оптической OD 600 . Распад холата мутантом с делецией и диким типом был очень похож (), но в отношении накопления промежуточных продуктов деградации наблюдались более выраженные различия. В частности, накопление 3-кетохолата ( 5 дюйм) было в три раза выше в мутантных культурах и длилось дольше, чем в культурах дикого типа, тогда как накопление следующих промежуточных продуктов Δ 4 -3-кетохолат ( 6 ) и HOCDA ( 11 ) была примерно на 50% ниже и наступила примерно через 2 часа (-).Комплементация мутанта с делецией плазмидным 5β-Δ 4 -kstd1 не дала четких различий в росте между комплементированным штаммом, контролем с пустым вектором и соответствующими контрольными штаммами дикого типа (данные не показаны). Вероятно, нагрузка от переноса плазмиды мешала положительному эффекту комплементации.

    Разложение холата ( 1 дюйм) суспензиями выращенных на глюкозе клеток Sphingobium sp. штаммы Chol11 wt (черный) и Δ 5β-Δ 4 -kstd1 (синий; OD 600 = 1) и временное накопление промежуточных продуктов 3-кетохолата ( 5 ), Δ 4 -3-кето -холат ( 6 ) и HOCDA ( 11 ) в бесклеточном культуральном супернатанте.Планки погрешностей указывают SD, которые могут быть не видны, если они слишком малы ( n = 3).

    Для более подробного анализа разложения холата и промежуточного накопления в суспензии покоящихся выращенных на глюкозе клеток добавляли холат (). Здесь наблюдалась аналогичная тенденция, как в экспериментах по выращиванию, со сравнимой деградацией холата менее чем за 5 часов обоими штаммами, усиленным накоплением 3-кетохолата ( 5 дюйма) и замедленным, а также сильно сниженным Δ 4 -3-кетохолат ( 6 ) и HOCDA ( 11 ) накопление в мутантных клетках по сравнению с клетками дикого типа.Эти результаты согласуются с функцией 5β-Δ 4 -KSTD. Однако потеря 5β-Δ 4 -kstd1 , по-видимому, могла быть дополнена другими генами. Для исследования того, является ли продолжительная лаг-фаза следствием отсроченной активации компенсаторных генов или более низкой активности альтернативных ферментов, суспензии клеток, выращенных на глюкозе, инкубировали с холатом и хлорамфениколом (2). Здесь деградация холата обоими штаммами была намного медленнее, а остаточный холат обнаруживался даже через 27 часов.В суспензиях обоих штаммов 3-кетохолат накапливался и не разлагался полностью через 27 ч, но в суспензиях клеток делеционного мутанта накопилось на 50% больше 3-кетохолата по сравнению с диким типом. Напротив, Δ 4 -3-кетохолат и HOCDA накапливались примерно в 5 раз больше в суспензиях дикого типа по сравнению с мутантными клетками, что указывает на то, что компенсаторные гены не могут быть экспрессированы.

    Разложение холата ( 1 дюйм) суспензиями выращенных на глюкозе клеток Sphingobium sp.штаммы Chol11 wt (черный) и Δ 5β-Δ 4 -kstd1 (синий; OD 600 = 1) в присутствии хлорамфеникола и временное накопление промежуточных продуктов 3-кетохолата ( 5 ), Δ 4 -3-кето-холат ( 6 ) и HOCDA ( 11 ) в бесклеточном культуральном супернатанте. Хлорамфеникол добавляли после приготовления клеточных суспензий перед добавлением субстрата. Планки погрешностей указывают SD, которые могут быть не видны, если они слишком малы ( n = 3).

    УФ-хроматограммы ферментных анализов с 3-кетохолатом ( 5 дюйм) в качестве субстрата, K 3 Fe (CN) 6 в качестве акцептора электронов и клеточными экстрактами E. coli MG1655 pBBR1MCS5, несущими гены гомологов 5β-Δ 4 -KSTD1. Сплошной синий 5β-Δ 4 -kstd1 , синий пунктир nov2c085 , синий пунктир nov2c314 , все из Sphingobium sp. штамм Chol11; зеленый c211_11427 из P.stutzeri Chol1, красный casH из Rhodococcus jostii RHA1, черный пустой векторный контроль. Хроматограммы изображены со смещением как времени удерживания, так и интенсивности для облегчения различения. Серый цвет указывает время удерживания Δ 4 -3-кетохолата ( 6 ). Ферментные анализы были проанализированы с помощью ВЭЖХ-МС, а стероидные соединения были идентифицированы по времени удерживания, оптической плотности и масс-спектру.

    As 5β-Δ 4 -KSTD1, по-видимому, участвует в первых этапах деградации холата, что также может представлять собой механизм детоксикации солей желчных кислот в Sphingobium sp.штамм Chol11, влияние делеции Δ 5β-Δ 4 -kstd1 на чувствительность к холату Sphingobium sp. штамм Chol11.

    Эксперименты по выращиванию с различными концентрациями холата показали, что Sphingobium sp. штамм Chol11 дикого типа легко рос с 1 и 2 мМ холата, в то время как рост непостоянно замедлялся с помощью 3 мМ и полностью подавлялся с помощью 5 мМ (дополнительные рисунки S6A, B). С обоими, 2 и 3 мМ холатом, Sphingobium sp.штамм Chol11 Δ 5β-Δ 4 -kstd1 рост был задержан по сравнению с диким типом с лаг-фазой около 2 часов (дополнительная фигура S6B). Для дальнейшего изучения чувствительности к холату Sphingobium sp. Для штамма Chol11 определяли оставшиеся КОЕ в суспензиях клеток после инкубации с различными концентрациями холата (дополнительные рисунки S6C, D). Однако достоверных различий между Sphingobium sp. штамм Chol11 дикого типа и Δ 5β-Δ 4 -kstd1 .В то время как 1 мМ холат не оказывал влияния на оба штамма через 15 и 90 минут, КОЕ в суспензиях клеток обоих штаммов, инкубированных с 10 мМ холатом, уменьшались в 10 и 100 раз через 15 и 90 минут соответственно. При инкубации с 50 мМ холатом КОЕ в обеих суспензиях клеток снизились в 10 раз 6 через 15 мин, и через 90 мин не удалось обнаружить КОЕ.

    5β-Δ

    4 -KSTD1 Гомологи присутствуют во многих бактериях, разлагающих желчные соли

    В принципе, разложение желчных солей, обнаруженное у некоторых бактерий, всегда должно включать 5β-Δ 4 -KSTD, поскольку эта реакция необходима для как Δ 1,4 -, так и Δ 4,6 -вариант.Поэтому в геномах известных бактерий, разлагающих соли желчных кислот, был проведен поиск потенциальных гомологов 5β-Δ 4 -KSTD1 (). В геноме Sphingobium sp. штамм Chol11 (сборочный номер RefSeq GCF_
    8065.1), существование изоферментов было предсказано из-за фенотипа мутанта с делецией, а также двух других ферментов Old Yellow с 46 и 62% идентичностью с 5β-Δ 4 -KSTD1, соответственно , были найдены. Однако ни один гомолог не был обнаружен во время протеомных исследований (неопубликованные результаты).В каждой по P. stutzeri Chol1, Azoarcus sp. штамм Aa7, C. testosteroni CNB-2, Dietzia sp. штамм Chol2, а также R. jostii RHA1, которые, как известно, катализируют 5β-стероид-Δ 4 -дегидрирование (Philipp et al., 2006; Horinouchi et al., 2012; Mohn et al., 2012; Holert et al., 2014; Yücel et al., 2018a), один соответствующий гомолог с идентичностями между 28% для CasH из R. jostii RHA1 и 48% для предполагаемого 5β-Δ 4 -KSTD из Azoarcus sp.штамм Aa7. Все потенциальные гомологи имели сходную доменную структуру, принадлежащую к семейству Old Yellow Enzyme, и на 28-30% идентичны BaiCD из C. scindens {«type»: «entrez-protein», «attrs»: {«text»: » VPI12708 «,» term_id «:» 16457 «,» term_text «:» VPI12708 «}} VPI12708. Соответствующие гены, кодирующие CasH из R. jostii RHA1 и CtCNB1_1320 из C. testosteroni , расположены в кластерах генов деградации холата (Horinouchi et al., 2012; Mohn et al., 2012), но назначить функцию пока не удалось (Bergstrand et al., 2016).

    Таблица 3

    Гомологи 5β-Δ 4 -KSTD1 в нескольких известных организмах, разлагающих соли желчных кислот, и их идентичность с 5β-Δ 4 -KSTD1 и BaiCD.


    00 UPI000BE23967 9002 9002 UPI
    Штамм Белок UniProt-ID Идентичность (%)
    5β-Δ 4 -KSTD1 BaiCD
    Sphing.штамм Chol11 5β-Δ 4 -KSTD1 UPI000BE3811D 100 28
    Nov2c085 UPI000BE23967 46 30 46 30
    30
    Pseudomonas stutzeri Chol1 c211_11427 K5YL27 44 28
    Comamonas testosteroni CNB-2 CtCNB1 CNB-2 Ct20J84 CtCNB1 sp.штамм Aa7 AZOA_21170 {«type»: «entrez-protein», «attrs»: {«text»: «WP_1

    088.1″, «term_id»: «1

    1053″, «term_text»: «WP_1

    088.1″ }} WP_1

    088.1

    48 30
    Rhodococcus jostii RHA1 CasH {«type»: «entrez-protein», «attrs»: {«text»: «Q0S «,» term_id «:» 122955201 «,» term_text «:» Q0S3N3 «}} Q0S3N3 28 30
    Dietzia sp.штамм Chol2 2,765 NA ∗∗ 41 30
    Clostridium scindens VPI 12708 BaiCD {«type»: «entrez-protein», «attrs»: text «:» P19410 «,» term_id «:» 172046821 «,» term_text «:» P19410 «}} P19410 28 100
    BaiH {» type «:» entrez-protein «,» attrs «: {» text «:» P32370 «,» term_id «:» 416702 «,» term_text «:» P32370 «}} P32370 29 32

    Для проверки функции этих гомологов выбрано гены были экспрессированы в E.coli MG1655 и соответствующие ферменты были протестированы в клеточных экстрактах с 3-кетохолатом ( 5 дюйм) и K 3 Fe (CN) 6 . CasH из R. jostii RHA1, аналогичный 5β-Δ 4 -KSTD1, был способен окислять 3-кетохолат до Δ 4 -3-кетохолат ( 6 ;), а также производные желчных солей 3-кетохенодезоксихолат, 3-кетодезоксихолат, 3-кетоурсодезоксихолат и 3-кетолитохолат с различными замещениями гидроксигрупп в соответствующих Δ 4 -3-кето-желчных соли ( 20 22 на дополнительном рисунке S 14 и дюйм, соответственно; дополнительный рисунок S4).Напротив, в ферментных анализах нельзя было обнаружить активности с Nov2c085 и Nov2c314, гомологами из Sphingobium sp. штамм Chol11 или C211_11427 из P. stutzeri Chol1 для всех протестированных солей желчных кислот (дополнительный рисунок S4). Соответственно, соответствующий немаркированный мутант с делецией P. stutzeri Chol1, P. stutzeri Chol1 Δ c211_11427 не показал измененного фенотипа в отношении роста с холатом в качестве единственного источника углерода, хотя дальнейшие гомологи в его составе не были обнаружены. геном (данные не показаны).

    Филогенетическое дерево гомологов 5β-Δ 4 -KSTD1 и других ферментов из старого семейства желтых ферментов. Дерево было построено на основе выравнивания ClustalW и метода максимальной экономии. Цвета ветвей обозначают указанные значения начальной загрузки. Белки были выбраны в результате поиска BLAST среди хорошо охарактеризованных белков с подтвержденной функцией или структурой или из известных бактерий, разлагающих соли желчных кислот. Желтая заливка: ферменты с подтвержденной функцией 5β-соли желчной 5β-желчная соль Δ 4 -дегидрогеназная функция.

    На филогенетическом дереве вместе с хорошо охарактеризованными ферментами из семейства Old Yellow Enzyme, 5β-Δ 4 -KSTD1, CasH, а также BaiCD и BaiH, которые были экспериментально подтверждены как 5β-Δ 4 -KSTD, образовали кластер вместе с несколькими другими дегидрогеназами, которые могут трансформировать сложные субстраты, такие как даидзеин (). В этом кластере гомологи из нескольких протеобактерий, разлагающих соли желчных кислот, таких как Sphingomonadaceae , P. stutzeri, Chol1 и C.testosteroni обнаруживаются вместе с 5β-Δ 4 -KSTD1, тогда как BaiCD и BaiH, а также CasH, по-видимому, более далеки от них. Однако при данном выборе белков стероиддегидрогеназы, по-видимому, не группируются отдельно от ферментов с другими функциями.

    Обсуждение

    В этой работе мы идентифицировали и охарактеризовали флавоэнзим 5β-Δ 4 -KSTD1, катализирующий превращение 3-кетохолата ( 5 дюйм) в Δ 4 -3-кетохолат ( 6 ) in Sphingobium sp.штамм Chol11 и проанализировал его физиологическую роль в разложении токсичных солей желчных кислот. Очевидно, 5β-Δ 4 -KSTD1 очень похож на 5β-Δ 4 -KSTD из C. testosteroni , который был очищен несколько десятилетий назад и для которого не существовало информации о последовательности (Davidson and Talalay, 1966).

    5β-Δ 4 -KSTD1 характеризуется очень высокой удельной активностью и относительно низкой K m по сравнению с большинством других ферментов (Bar-Even et al., 2011), а также выраженное ингибирование субстрата. Что касается токсичности солей желчных кислот в качестве субстратов для роста, низкая K m и высокая текучесть субстрата являются очевидными преимуществами для быстрого ослабления токсических свойств путем трансформации солей желчных кислот. Необходимость механизма быстрой детоксикации у Sphingobium sp. штамм Chol11 стал очевидным при воздействии высоких концентраций холата, таких как 10 мМ, что привело к значительному снижению КОЕ.Для быстрого ответа 5β-Δ 4 -KSTD1 должен постоянно присутствовать в Sphingobium sp. штамм клеток Chol11. Тот факт, что выращенные на глюкозе клетки Sphingobium sp. Chol11 были легко индуцированы для преобразования холата в HOCDA ( 11 ), что указывает на базальную экспрессию соответствующих генов 3α-HSD, 5β-Δ 4 -KSTD и 7α-гидроксистероиддегидратазы, участвующих в этой предполагаемой детоксикации. .

    Фенотип мутанта с делецией показал, что 5β-Δ 4 -KSTD1 не важен для роста и деградации холата и что должны существовать изоферменты.Однако особенно измененное накопление 3-кетохолата ( 5 дюйм) и Δ 4 -3-кетохолата ( 6 ) в мутантных культурах указывает на заметную роль in vivo для 5β-Δ 4 — KSTD1. Кроме того, это также показало, что изоферменты должны быть активированы, что дополнительно подтверждается сильно отсроченным превращением холата в HOCDA ( 11 ) в присутствии блокирующего трансляцию хлорамфеникола. Незначительное влияние делеции на рост с холатом вместе с более сильным влиянием на промежуточную концентрацию указывает на то, что первые шаги деградации, включая образование двойной связи Δ 4 , не определяют скорость разложения солей желчных кислот.Таким образом, и соответствующие кинетическим параметрам 5β-Δ 4 -KSTD1, первые шаги должны выполняться очень быстро, тогда как следующие шаги, такие как деградация боковой цепи, могут определять скорость. Кинетика разложения холата с заметным временным накоплением Δ 4 -3-кетохолата ( 6 ) и HOCDA ( 11 ) указывает на то, что их дальнейший метаболизм является узким местом в этом катаболическом пути.

    В отличие от высокого оборота и субстратной специфичности 5β-Δ 4 -KSTD1, преимущество субстратного ингибирования роста токсичными солями желчных кислот менее очевидно.Хотя ингибирование субстрата, по-видимому, является очень распространенным явлением, его физиологические функции в основном неизвестны, но, по-видимому, очень разнообразны (Reed et al., 2010). Эти функции также включают гомеостаз метаболических путей. Активность Hsh3 и CoA-лигазы SclA, ферментов, следующих за 5β-Δ 4 -KSTD1 в деградации солей желчных кислот, намного ниже по сравнению с очень высокой активностью 5β-Δ 4 -KSTD1 (Yücel et al., 2016, 2018b). Таким образом, продукт 5β-Δ 4 -KSTD1 Δ 4 -3-кетохолат накапливался бы в больших количествах, если бы 5β-Δ 4 -KSTD1 неограниченно функционировал с максимальной активностью.Перелив Δ 4 -3-кетохолата может привести к истощению пулов акцепторов электронов и КоА. Не обладая субстратным ингибированием, 5β-Δ 4 -KSTD1 может приводить к окислительно-восстановительному дисбалансу за счет прямого или косвенного снижения больших количеств цитохромов, НАД (Ф) или убихинона всякий раз, когда высокие концентрации солей желчных кислот приводят к высоким концентрациям солей 3-кето желчных кислот. присутствуют в ячейке. Предполагается, что истощение свободного КоА является причиной токсичности холестерина у мутантов Mycobacterium tuberculosis , лишенных генов, участвующих в деградации HIP ( 10 ; Crowe et al., 2017). Предположительно, в этих штаммах накапливаются соединения HIP-CoA, связывающие большие части пула CoA. У Sphingobium sp. штамм Chol11, субстратное ингибирование 5β-Δ 4 -KSTD1 непосредственно снижает потребность в CoA для Δ 4 -3-кетохолата и последующего промежуточного HOCDA, которые являются субстратами для стероид-CoA лигазы Scl1 (Yücel et al., 2018b ). Исходя из этих соображений, субстратное ингибирование 3-кетохолатом ( 5 дюйм) можно интерпретировать как прерыватель цепи желчно-солевого метаболизма.

    Обуздание или даже прекращение катаболизма желчных солей путем ингибирования субстратом могло бы создать высокие уровни внутриклеточных желчных солей, а также остановить рост. В соответствии с этим, Sphingobium sp. штамм Chol11 демонстрировал замедленный рост с 3 мМ холата и не рос при концентрациях холата выше 5 мМ. Конечно, это отключение, по крайней мере, частично могло быть связано с токсическим действием холата. Следовательно, клетки должны иметь возможность быстро снижать уровень желчных солей, откачивая их из клетки.Существование соответствующих насосов оттока убедительно подтверждается временным внеклеточным накоплением 3-кетохолата, Δ 4 -3-кетохолата и HOCDA в супернатанте культуры. На сегодняшний день не было выявлено никаких специфических насосов оттока у бактерий, разлагающих соли желчных кислот. Однако, поскольку временное накопление промежуточных продуктов разложения солей желчных кислот является обычным явлением у соответствующих бактерий, представляется оправданным постулировать, что такие оттокные насосы очень важны для обеспечения роста с этими токсичными субстратами (Swain et al., 2012; Holert et al., 2014). Кроме того, последующие метаболиты деградации холата также могут оказывать токсическое действие на клетки, и, следовательно, ингибирование субстрата могло бы предотвратить потенциальное накопление этих метаболитов. Токсические эффекты известны для андроста-1,4-диен-3,17-дионов (ADD, такие как 12β-DHADD, 8 in; Perez et al., 2003; Philipp et al., 2006), а также постулируется для других промежуточных продуктов деградации бактериальных солей желчных кислот (Swain et al., 2012).

    5β-Δ 4 -KSTD1 продемонстрировал ослабленную субстратную специфичность в отношении боковой цепи и характера гидроксилирования для 5β-стероидов, включая производные всех солей желчных кислот человека.Напротив, он не проявлял активности с 5α-стероидами, имеющими плоскую конформацию стероидного скелета. Хотя только два 5α-стероида могли быть протестированы из-за их ограниченной коммерческой доступности, было очевидно, что специфичность 5β-Δ 4 -KSTD1 была продиктована изогнутой конформацией стероидного скелета, а не наличием или отсутствием карбоксильной группы. боковая цепь. Эта конформационная специфичность отражается в низком сходстве с 5α-Δ 4 -KSTD, что указывает на другое филогенетическое происхождение.

    5β-Δ 4 -KSTD1, а также 5β-Δ 4 -KSTD BaiCD и BaiH из C. scindens имеют общий размер и состав кофакторов и принадлежат к так называемой термофильной подгруппе старых желтых ферментов (Peters et al., 2019), что подтверждается филогенетическим анализом. Для 5β-Δ 4 -KSTD BaiCD долгое время предполагалось (Ridlon et al., 2006; Kang et al., 2008), а недавно было показано (Funabashi et al., 2020), что предпочтительным субстратом является CoA- связанная 3-кето-желчная соль.Для 5β-Δ 4 -KSTD1 из Sphingobium sp. штамм Chol11, маловероятно, что 3-кетохолил-CoA (CoA-эфир 5 дюйма) является субстратом, поскольку CoA-лигаза, добавляющая CoA к боковой цепи желчных солей C 5 , SclA, сильно предпочитает Δ 4 -3-кетохолат ( 6 ) и HOCDA ( 11 ) по сравнению с 3-кетохолатом (Yücel et al., 2018b), что указывает на то, что окисление A-кольца происходит первым. Поскольку дегидрирование 3-кетохолата возможно с помощью искусственных акцепторов электронов K 3 Fe (CN) 6 , PMS и DCPIP, хиноны, вероятно, являются естественными акцепторами электронов 5β-Δ 4 -KSTD1.Этот вывод согласуется с более ранними ферментативными исследованиями клеточных экстрактов Sphingobium sp. штамм Chol11 (Yücel et al., 2016) и P. stutzeri Chol1 (Birkenmaier et al., 2007), в которых также не наблюдалось окисления 3-кетохолата с помощью NAD + , а скорее требовалось K 3. Сообщалось о Fe (CN) 6 или PMS. Напротив, BaiCD из C. scindens использует NAD + в качестве акцептора электронов. Также было показано, что он катализирует обратную реакцию с использованием НАДН в качестве донора электронов (Kang et al., 2008; Funabashi et al., 2020). То же самое было описано для BaiH, который обладает активностью окисления 3-кетурсодезоксихолата с NAD + в качестве со-акцептора электронов, но также катализирует NADH-зависимое восстановление двойной связи Δ 6 в промежуточных соединениях, таких как HOCDA ( 11 ; Франклунд и др., 1993; Канг и др., 2008). Как правило, было показано, что несколько старых желтых ферментов снижают содержание стероидов (Williams and Bruce, 2002; Toogood et al., 2010). Однако восстановление Δ 4 -3-кетохолата 5β-Δ 4 -KSTD1 с помощью NAD (P) H не может быть измерено.

    На основании последовательности гомологи 5β-Δ 4 -KSTD могут быть обнаружены у известных бактерий, разлагающих соли желчных кислот. Однако дополнительные два гомолога у Sphingobium sp. штамм Chol11 не проявлял какой-либо активности 5β-Δ 4 -KSTD по отношению к какой-либо испытанной желчной соли и, следовательно, не мог объяснить фенотип делеционного мутанта Sphingobium sp. штамм Chol11 Δ 5β-Δ 4 -kstd1 . Возможное объяснение может заключаться в том, что эти ферменты обрабатывают эфиры CoA 3-кетобильных солей, которые не могут быть получены в этих анализах.Однако вышеупомянутая субстратная специфичность КоА-лигазы противоречит этой теории. Точно так же единственный гомолог C211_11427 5β-Δ 4 -KSTD1 из P. stutzeri Chol1 не проявлял никакой активности в отношении какой-либо соли 3-кето-желчи. Маловероятно, что эти гены не могли функционально экспрессироваться в E. coli , потому что несколько Sphingobium sp. гены штамма Chol11, включая очень похожие гены 5β-Δ 4 -kstd1 , были успешно экспрессированы в этом хозяине (Yücel et al., 2016, 2018b). Кроме того, отсутствие фенотипа делеционного мутанта вышеупомянутого гена-кандидата c211_11427 из P. stutzeri Chol1 подтверждает, что этот фермент не отвечает за дегидрирование 3-кетохолата в этой бактерии. Эти результаты показывают, что еще неизвестные альтернативные ферменты, катализирующие эту реакцию, должны существовать в некоторых бактериях, разлагающих соли желчных кислот, которые значительно различаются по своей последовательности и, вероятно, принадлежат к другому семейству белков.

    Из всех протестированных гомологов только CasH из кластера деградации стероидов в R.jostii RHA1 был подтвержден как 5β-Δ 4 -KSTD. CasH кодируется в кластере генов деградации холата, рядом со многими генами cas , кодирующими ферменты деградации боковой цепи стероидных карбоксильных C 5 (Mohn et al., 2012). В качестве гомологов CasH и {«type»: «entrez-protein», «attrs»: {«text»: «ACY32066.1», «term_id»: «262207968», «term_text»: «ACY32066.1»}} ACY32066.1 из C. testosteroni не может быть обнаружен у всех стероид-деградирующих бактерий, предполагалось, что они не связаны с деградацией стероидов (Bergstrand et al., 2016). Однако гомологи 5β-Δ 4 -KSTD1 необходимы только для деградации подгруппы стероидов. Тем не менее, они включают в себя основной продукт трансформации кишечного холестерина копростанол, а также многие стероидные токсины.

    Высокая эффективность и универсальность 5β-Δ 4 -KSTD1 как один из факторов способности Sphingobium sp. штамм Chol11 для трансформации большого количества солей желчных кислот, а также множественность соответствующих ферментов деградации позволяют предположить, что Sphingobium sp.штамм Chol11, по-видимому, хорошо адаптирован к среде, содержащей соли желчных кислот. Кроме того, разложение солей желчных кислот также наблюдается у штаммов других типов из этого семейства (неопубликованные результаты). Поскольку сфингомонады не известны как типичные представители микробиома позвоночных, происхождение и сохранение этих свойств неочевидно, но, безусловно, привлекает внимание к экологии и истории эволюции этой группы α-протеобактерий.

    Вакуумный автоматический выключатель | Строительство

    Вакуумный автоматический выключатель:

    Хотя преимущества прерывания дуги в вакууме были признаны еще в девятнадцатом веке, это не нашло широкого применения до нескольких лет назад.Это произошло потому, что знание проблем материаловедения, вакуумной технологии и физики плазмы не было достаточно развитым, чтобы обеспечить решение многих технологических проблем, возникающих при проектировании и изготовлении надежного вакуумного выключателя.

    Высокий вакуум обладает двумя выдающимися свойствами: (1) наивысшая из известных изолирующих свойств и (2) когда a, c. цепь размыкается разделением контактов в вакууме, прерывание происходит при первом нулевом токе, при этом электрическая прочность изоляции на контактах увеличивается со скоростью в тысячи раз выше, чем у обычных автоматических выключателей.Эти свойства, очевидно, делают вакуумный автоматический выключатель более эффективным, менее громоздким и дешевым. Срок службы также намного больше, чем у обычного оборудования, и практически не требуется никакого обслуживания. Вакуумные выключатели идеально подходят для большинства задач, встречающихся в типичных электрических сетях и промышленных приложениях. Их напряжение и отключающая способность таковы, что с небольшими изменениями они могут быть выполнены для выполнения определенных функций переключения при высоком напряжении a. c. системы. Практический опыт подтвердил уникальные характеристики и надежность вакуумных устройств.

    Вакуумная среда:

    Каждая среда, имеющая давление ниже атмосферного (760 мм рт. Ст.), Называется вакуумом. Торричелли известен как первый человек, которому удалось эвакуировать пространство, построив свой ртутный барометр. Низкое давление измеряется в торр, где 1 торр = 1 мм рт. Ст. Теперь с помощью различных усовершенствованных технологий можно достичь давления до 10 -7 торр.

    Значение давления среды оказывает заметное влияние на молекулярную структуру среды.В диапазонах высокого давления вакуумной системы длина свободного пробега очень мала, и молекулы находятся в постоянном состоянии столкновения, газ ведет себя как жидкость и, как известно, находится в состоянии вязкого потока . При уменьшении давления длина свободного пробега увеличивается. В конце концов достигается точка, в которой длина свободного пробега равна или больше размеров камеры ограничения. В этом случае молекулы будут чаще сталкиваться со стенками камеры, чем друг с другом.В этой области говорят, что газ находится в состоянии молекулярного потока .

    Разделение между двумя областями определяется безразмерным параметром, называемым числом Кнудсена . Для цилиндрической трубки число Кнудсена определяется как отношение длины свободного пробега (L м ) молекул газа к радиусу (R). При L м / R менее 0,01 поток газа вязкий; если соотношение больше 1, поток является молекулярным. Диапазон между этими двумя пределами называется диапазоном перехода.В таблице 16.1 показано значение длины свободного пробега для N 2 при различных значениях давления. Газовая среда в вакуумных устройствах прерывания обычно находится в диапазоне молекулярных потоков.

    Вакуумная дуга:

    Когда происходит разделение контактов в воздухе, ионизированные молекулы, вероятно, являются основными переносчиками электрических зарядов и ответственны за низкую величину пробоя. В вакуумной дуге нейтральные атомы, ионы и электроны должны в конечном итоге исходить от самих электродов, а не от среды, в которой возникает дуга.Когда токопроводящие контакты разъединяются, ток концентрируется в нескольких локальных высоких точках на контактных поверхностях. Нормальная проводимость через металл прекращается, когда испаряется последняя перемычка между двумя контактами. Явления в активных точках на электродах вакуумного силового выключателя аналогичны явлениям в обычных дугах высокого давления, где плотность тока находится в диапазоне 10 5 -10 6 ампер / см 2 . В вакуумной дуге излучение происходит только в катодных пятнах, а не со всей поверхности катода.По этой причине вакуумная дуга также известна как дуга с холодным катодом .

    Фактически, испускание электронов и ионов из катодных пятен может происходить из-за любого или комбинации следующих механизмов:

    • Термоэлектронная эмиссия.
    • Автоэмиссия.
    • Термоэлектронная и автоэлектронная эмиссия.
    • Вторичная эмиссия в результате бомбардировки положительными ионами.
    • Вторичное излучение фотонов.
    • Пинч-эффект излучения.

    При высоких токах ионизированный пар металла распространяется через довольно большой объем, окружающий электроды. При более низких токах количество производимого пара значительно уменьшается. Поскольку пар, выделяющийся из катодных пятен, быстро расширяется в вакууме, вероятность поддержания плотности носителей заряда, достаточной для сохранения адекватной проводимости в столбе и поддержания процесса эмиссии, становится все более малой.При нулевом токе катодные пятна гаснут за время порядка 10 -2 секунды.

    Стабильность вакуумной дуги:

    В сети переменного тока 50 Гц В сети ток уменьшается до нуля каждые 10 мс. Если цепь прерывается в точке нулевого тока, перенапряжения не возникает. Следовательно, для успешного прерывания необходимо, чтобы дуга была стабильной в течение полупериода и, в частности, чтобы она продолжала существовать при токах, приближающихся к нулю. Было обнаружено, что стабильность дуги зависит от (I) материала контакта и давления его паров и (2) параметров цепи, таких как напряжение, ток, емкость и индуктивность.В слаботочных цепях большая часть испарения происходит в дискретных точках, известных как катодные пятна; при более высоких токах газ испаряется из катодных и анодных пятен. В дополнение к этим источникам в кожух контактов добавляется газ, когда он отделяется от других частей кожуха из-за высокой температуры и попадания паров металла.

    Было показано, что давление пара и стабильность дуги взаимосвязаны. Чем выше давление пара при более низких температурах, тем дольше срок службы дуги.На рисунке (16.2) показано среднее время жизни дуги для некоторых чистых металлов, а на рисунке (16.3) показано соотношение между давлением и температурой для различных металлов.

    Шунтирование контактов с разными значениями емкости показывает, что чем больше емкость, тем меньше средний срок службы дуги. Добавление большой индуктивности последовательно с контактами Cu-Bi приводит к увеличению длительности дуги. Уровень прерывания зависит от давления пара и теплопроводности материала катода.Хороший теплопровод будет очень быстро остывать, и температура его контактной поверхности упадет. Это снизит скорость испарения, и дуга погаснет из-за недостатка пара. С другой стороны, плохой проводник тепла будет дольше поддерживать свою температуру и испарение, и дуга будет более стабильной.

    Вакуумный пробой:

    Основными изоляционными материалами являются атмосферный воздух, масло, бумага и фарфор. Они могут выдерживать значительное напряжение, но они незначительны по сравнению с выдерживаемым напряжением промежутка в вакууме.Рисунок (16.4) иллюстрирует сопротивление разрушению различных изоляционных материалов.

    Обычно напряжение, которое выдерживает промежуток, уменьшается при понижении давления (фактически плотности) до минимума, а затем начинает быстро расти при дальнейшем уменьшении плотности окружающего газа. Это проиллюстрировано на рис. (16.5), который показывает идеализированную кривую Пашена , где напряжение пробоя построено как функция зависимости давления от длины промежутка.

    Когда давление снижается ниже точки, в которой длина свободного пробега молекул остаточного газа порядка размеров трубки, примерно 1 микрон во многих практических случаях, напряжение пробоя перестает зависеть от газа внутри емкости и подвергается наибольшему влиянию. сильно по составу, состоянию и расположению поверхностей электродов и стенок трубки.Этот переходный диапазон показан на рис. (16.5) заштрихованным. Ниже переходного диапазона это высокий вакуум порядка 10 -4 -10 -6 торр, и длина свободного пробега молекул остаточного газа становится очень большой по сравнению с зазором между электродами (см. Таблицу 16.1). В промежутке в 1 см всего несколько электронов из миллиона сталкиваются с молекулами и образуют ионы. Именно этот факт является причиной очень высокой прочности вакуума на пробой. В этом диапазоне прочность на пробой не зависит от плотности газа, но зависит только от длины зазора.Следовательно, зависимость прочности на пробой от длины зазора отображается только в этой области.

    Инициирование вакуумного пробоя, как и вакуумная дуга, должно зависеть от продуктов, выделяемых под действием сильных полей от электродов и стенок, которые бомбардируются электронами, испускаемыми полем, а не от среды, в которую погружены электроды.

    Фактическое значение напряжения пробоя для данного промежутка довольно сильно зависит от состояния поверхностей электродов. Полированные и тщательно дегазированные электроды показали особенно высокое напряжение пробоя.Контакты становятся шероховатыми после образования дуги, и, таким образом, прочность на пробой снижается. Как правило, повышение прочности на пробой после образования дуги может быть достигнуто путем применения последовательных импульсных искр высокого напряжения. Это не изменяет до какой-либо заметной степени шероховатости поверхностей дуги, но, вероятно, удаляет неплотно приставшие металлические частицы с электродов, осажденных там паровой струей во время дугового разряда.

    На рисунке (16.6) показано среднее статическое напряжение пробоя в зависимости от длины промежутка для нескольких шероховатых поверхностей электродного материала в вакууме порядка 10 -6 торр.Аналогичные данные о пробое для N 2 (воздух) показаны для сравнения. Большинство материалов, показанных здесь, приобретают большую часть своей предельной прочности на пробой при зазоре менее 3 мм для конкретной показанной геометрии. Такая характеристика позволяет использовать короткие промежутки в вакуумных переключателях, что приводит к упрощению рабочего механизма и увеличению скорости работы по сравнению с обычными переключателями.

    Прерывание тока:

    По мере падения тока дуга имеет тенденцию гаснуть при конечном уровне тока, значение которого зависит от давления паров и характеристик электронной эмиссии материала контактов, в отличие от масляных или воздушных выключателей, где обычно принято считать, что ток резка возникает из-за нестабильности в колонке.Резка приводит к чрезмерным перенапряжениям, которые ставят под угрозу изоляцию системы и вызывают повторное зажигание дуги. Желательно рассеивать энергию в самой дуге, и с этой точки зрения повторное зажигание, возникающее после рубки, приветствуется. Однако в основном следует избегать измельчения. Можно снизить уровень тока, при котором происходит резка, путем выбора материала контакта, который выделяет достаточно пара металла, чтобы позволить току достичь очень низкого или нулевого значения, но это делается редко, так как это может повлиять на другие свойства, в частности диэлектрическая прочность.

    Характеристики восстановления вакуумных устройств:

    Уже говорилось, что высокий вакуум обладает чрезвычайно высокой диэлектрической прочностью. При нулевом токе катодное пятно гаснет в течение 10 -8 секунды, после чего устанавливается исходная диэлектрическая прочность. Такое быстрое возвращение высокой диэлектрической прочности происходит, конечно, из-за того, что испаренный металл, который находится между контактами, быстро диффундирует из-за отсутствия молекул газа.Молекулы металла с большой скоростью выдуваются к стеклянным стенкам и там конденсируются.

    Скорость восстановления диэлектрика вакуумного промежутка в первые несколько микросекунд после прерывания дуги составляет примерно 1 кВ / мк. с для тока дуги 100 А по сравнению с 50 В / мкс в случае воздушного зазора. На рисунке (16.7) показаны скорости восстановления различных газов и вакуума. Газы находятся под атмосферным давлением, током 1600 А при расстоянии открытого зазора 6,35 мм.

    Благодаря вышеупомянутым характеристикам вакуумных прерывателей, вакуумный автоматический выключатель может использоваться без резервирования для устранения неисправности в любом месте системы.Они могут без труда справиться с тяжелыми переходными процессами восстановления, связанными с короткими замыканиями на линии или сбоями вблизи трансформатора. Все формы переключения нагрузки могут выполняться с одинаковой легкостью.

    Материалы контактов:

    Приведенные выше соображения показывают, что наиболее важной частью вакуумного автоматического выключателя является выбор материала контактов. Желательные свойства контактного материала вакуумного автоматического выключателя можно перечислить следующим образом.

    • Хорошая электропроводность для пропускания нормальных токов нагрузки без
    • Хорошая теплопроводность для быстрого отвода большого количества тепла, выделяемого во время дуги.
    • Высокая твердость в холодном и горячем состоянии для предотвращения износа при нормальных операциях открывания и закрывания.
    • Высокая плотность.
    • Достаточно низкое давление пара для уменьшения количества неотделимых паров металла в камере.
    • Теплота испарения должна быть такой, чтобы (i) энергия дуги генерировала достаточно пара металла, чтобы поддерживать дугу до первого нулевого естественного тока, и (ii) присутствовало недостаточно пара, чтобы вызвать повторное зажигание после первого нулевого тока.
    • Высокотемпературная функция для преждевременного гашения дуги.
    • Сопротивление сварке вместе.
    • Высокая температура кипения для уменьшения дуговой эрозии. Высокая температура кипения означает высокую теплоту испарения и большее рассеивание энергии дуги при испарении материала на катодном пятне.
    • Желательно, чтобы материал не имел поверхностной пленки. Если пленки нельзя избежать, то она должна быть дирижирующей.
    • Низкое содержание газа. Содержание газа в материале должно составлять одну часть на 10 7 или меньше, чтобы обеспечить более длительный срок службы.
    • Достаточная механическая прочность для сохранения структурной целостности при высоких градиентах напряжения на поверхности.

    Наиболее важным требованием к контактному материалу является испускание пара низкого давления во время образования дуги. В то время как металлы с низким давлением пара лучше с точки зрения гашения дуги, металлы с высоким давлением пара и низкой проводимостью кажутся более желательными для ограничения неблагоприятных последствий из-за прерывания тока.

    Принимая во внимание множество требований, которым должен соответствовать материал контактов вакуумного выключателя, и учитывая широкий спектр доступных в настоящее время металлов, можно сказать, что не существует единого металла, который сочетал бы в себе все противоречивые свойства, перечисленные выше.Металлы с хорошей теплопроводностью и электропроводностью неизменно имеют низкие температуры плавления и кипения, высокое давление пара при высокой температуре, низкие электронные функции и значительно мягкие.

    Материалы с высокими температурами плавления и кипения имеют низкое давление пара при высоких температурах, но являются плохими проводниками. Следовательно, чтобы объединить эти противоречивые свойства в одном материале, необходимо создать композит из двух или более металлов или металла и неметалла.Некоторые из примеров — медь-висмут, медь-свинец, медь-теллур, медь-таллий, серебро-висмут, серебро-свинец и серебро-теллур. На рисунке (16.8) показаны характеристики некоторых из этих металлов.

    Металлы промышленного производства содержат следы других элементов и захваченных газов. После того, как выключатель опломбирован, невозможно удалить газообразные продукты, выделяющиеся во время повторяющихся операций, потому что это разрушит вакуум выключателя. Кроме того, на такие характеристики, как напряжение пробоя и скорость восстановления, влияет присутствие газов.Были разработаны методы дегазации металлов, которые обычно используются в электротехнической и электронной промышленности. Безгазовые металлы получают путем вакуумной плавки в индукционных печах с последующим раскислением серой или углеродом.

    Конструкция вакуумного переключателя:

    Вакуумный автоматический выключатель — очень простое устройство по сравнению с масляными или воздушными выключателями. Два контакта установлены внутри изоляционного герметичного контейнера. Один фиксируется, а другой можно перемещать на небольшое расстояние.Металлический экран окружает контакты и защищает изолирующий контейнер. Типичный узел вакуумного выключателя показан на рис. (16.9). Он состоит из двух подузлов: (а) вакуумной камеры и (б) рабочего механизма.

    (a) Вакуумная камера: Она изготовлена ​​из синтетического материала, такого как уратановая пена, которая заключена во внешнюю армированную стекловолокном пластиковую трубку, или из простого стекла или фарфора, два контакта, металлический экран и металлический сильфон герметично закрыты внутри. камера.По уже указанным причинам контакты должны быть чистыми и тщательно дегазированы.

    Металлический сильфон, обычно сделанный из нержавеющей стали, используется для перемещения нижнего контакта и обеспечивает зазор порядка 5-10 мм в зависимости от применения переключателя. Конструкция сильфона имеет особое значение, поскольку срок службы переключателя зависит от способности этой части удовлетворительно выполнять повторяющиеся операции

    Один конец неподвижного контакта выведен из камеры, к которой может быть выполнено внешнее соединение.Аналогичным образом предусмотрен нижний контакт также для внешних соединений, но он прочно соединен с приводной штангой механизма.

    (b) Привод: Нижний конец прикреплен к механизму с пружинным или соленоидным приводом, так что металлический сильфон внутри камеры перемещается вверх и вниз во время операций закрытия и открытия соответственно. Контактное движение должно быть таким, чтобы избежать отскока. Однако давление должно быть достаточным, чтобы обеспечить хорошее соединение между двумя контактами.

    Применение вакуумных переключателей:

    Они имеют многообещающее применение в коммутационных аппаратах высокого напряжения, особенно там, где требуется недорогой коммутатор с низкой отключающей способностью при отказе, но способный выполнять большое количество операций переключения нагрузки без обслуживания, а в некоторых приложениях — прерывание зарядки линии или конденсатора. ток без повторного пробоя. Если стоимость невысока, такое распределительное устройство было бы идеальным для управления высоковольтными шунтирующими батареями конденсаторов на небольших подстанциях или на больших подстанциях, где аварийное отключение может быть обработано другим распределительным устройством.Это очень высокоскоростные переключатели, которые могут использоваться во многих промышленных приложениях.

    Для такой страны, как Индия, с сетью от 11 до 33 кВ, простирающейся до обширного сельского комплекса, вакуумный автоматический выключатель должен оказаться несомненным преимуществом. Даже с ограниченным рейтингом МВА, скажем, от 60 до 100 МВА, он должен подходить для большинства приложений в сельской местности.

    % PDF-1.2 % 20775 0 объект > эндобдж xref 20775 76 0000000016 00000 н. 0000001879 00000 н. 0000012457 00000 п. 0000012641 00000 п. 0000013501 00000 п. 0000013560 00000 п. 0000013619 00000 п. 0000013678 00000 п. 0000013737 00000 п. 0000013796 00000 п. 0000013855 00000 п. 0000013914 00000 п. 0000013973 00000 п. 0000014032 00000 п. 0000014091 00000 п. 0000014150 00000 п. 0000014209 00000 п. 0000014268 00000 п. 0000014326 00000 п. 0000014418 00000 п. 0000014477 00000 п. 0000014536 00000 п. 0000014595 00000 п. 0000014654 00000 п. 0000014713 00000 п. 0000014771 00000 п. 0000014830 00000 н. 0000014889 00000 п. 0000015948 00000 п. 0000015972 00000 п. 0000016475 00000 п. 0000016601 00000 п. 0000017030 00000 п. 0000017507 00000 п. 0000018026 00000 п. 0000018573 00000 п. 0000019108 00000 п. 0000019189 00000 п.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *